Loading...

Strain Detail Sheet

Strain Name:
C57BL/6J-Naa10em3Lutzy/Mmjax
Stock Number:
071756-JAX
Citation ID:
RRID:MMRRC_071756-JAX
Other Names:
C57BL/6J-Naa10em3Lutzy/Mmjax

Strain Information

Gene Details

Naa10
Name: N(alpha)-acetyltransferase 10, NatA catalytic subunit
Synonyms: 2310039H09Rik, Te2, Ard1, Ard1a
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 56292
Homologene: 2608

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
The Naa10 null allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (TCTGAGCCAGGCCAAGGCGC) was used to target exon 5 of the N(alpha)-acetyltransferase 10, NatA catalytic subunit (Naa10) gene on chromosome X. Donor DNAs were originally designed to introduce missense mutation R83C and silent mutation R82R. Mouse Naa10-201 transcript (ENSMUST00000033763.15) was used as reference for the exon number and guide sequences. Guide RNA, cas9, and the ss oligo donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females.
Genotype Determination
ES Cell Line
Not applicable

Strain Description

Phenotype
Heterozygous mice appear phenotypically normal and are fertile. Homozygous females and hemizygous males are sub-viable and born below expected Mendelian ratios (16.3% and 15.4%, respectively, from Het x Hemi matings). Approximately 88% of homozygous females and all hemizygous males demonstrate some degree of piebaldism (i.e. white belly spots) and all homozygous females/hemizygous males where found to have supernumerary ribs.
Strain Development
The Naa10 null allele was generated using CRISPR/Cas9 endonuclease-mediated genome editing. A guide RNA (TCTGAGCCAGGCCAAGGCGC) was used to target exon 5 of the N(alpha)-acetyltransferase 10, NatA catalytic subunit (Naa10) gene on chromosome X. Donor DNAs were originally designed to introduce missense mutation R83C and silent mutation R82R. Mouse Naa10-201 transcript (ENSMUST00000033763.15) was used as reference for the exon number and guide sequences. Guide RNA, cas9, and the ss oligo donor were introduced to single cell C57BL/6J zygotes and transferred to pseudo pregnant females.
Suggested Control Mice
C57BL/6J or wildtype from colony

MMRRC Genetic QC

MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact csmmrrc@jax.org. Older strains may not have this information.

Research Applications

  • Neurobiology

Strain Origin

Donor
Cat Lutz, Ph.D., The Jackson Laboratory.
Primary Reference
Not ready to publish

Colony and Husbandry Information

Special Considerations

N/A

Health Status Report

For more information about this colony's health status contact csmmrrc@jax.org

Appearance

Coat Color
Coat color is black but approximately 88% of homozygous females and all hemizygous males demonstrate some degree of piebaldism (i.e. white belly spots)
Eye
Black

Breeding

MMRRC Breeding System
Sib-mating
Generation
2
Overall Breeding Performance
Good

Reproductive Statistics

NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes X-linked
Homozygotes are fertile: Reduced X-linked
Hetero/Hemizygotes are fertile: Yes Reduced
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Variable
Recommended wean age
4 Weeks
Average Pups Weaned
Variable

Order Request Information

Availability Level

Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Conditions of Distribution

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*		 Units Notes
071756-JAX-HET-F
071756-JAX-HET-M
071756-JAX-WT-F
071756-JAX-WT-M
Heterozygous / Hemizygous Female
Heterozygous / Hemizygous Male
Wild Type Female
Wild Type Male
 $229.00 / $229.00
Non-Profit / For-Profit		 Per Mouse The csmmrrc@jax.org may assess additional fees for any special requests (e.g., specific age or weight of mice, etc.).
071756-JAX-SPERM Cryo-preserved spermatozoa $459.00 / $459.00
Non-Profit / For-Profit		 Aliquot Approximate quantity3
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.