Syngap1^c.3583-9G>A mice have a single base substitution resulting in a cryptic splice acceptor site and premature stop codon in the Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] gene. Heterozygous mice display impaired synaptic plasticity, hyperactivity, and impaired working memory. This strain may be useful in studies of SRID (SYNGAP1-related intellectual disability).

• Syngap1^em2Rlh, Sanger sequencing

Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] encodes a synaptic RasGAP (SynGAP) that is largely localized to dendritic spines in neocortical pyramidal neurons, where it suppresses signaling pathways linked to NMDA receptor (NMDAR)-mediated synaptic plasticity and AMPA receptor (AMPAR) membrane insertion. Syngap1 has alternative transcriptional start sites and several alternatively spliced C-terminal exons that result in many possible SynGAP isoforms. Mutations in SYNGAP1 are associated with neurodevelopmental disorders, specifically SRID (SYNGAP1-related intellectual disability). SRID is characterized by cognitive impairment, social deficits, early-onset seizures and sleep disturbances.

The Syngap1c.3583-9G>A allele has a G to A substitution at c.3583-9G that results in a cryptic splice acceptor site and premature stop codon. The c.3583-9G>A mutation was identified in a human patient.?? Mice heterozygous for the mutation have a 40-50% reduction in Syngap1 mRNA and a 50% reduction in SYNGAP1 protein. In addition, heterozygous Syngap1^L813RfsX22 mice exhibit deficits in theta-burst stimulated induced long term potentiation and decreased spontaneous alternations, increased repetitive arm entries, and increased total arm entries in the Y maze. Heterozygous mice are viable and fertile, the donating investigator indicates that in homozygotes postnatal lethality occurs in 3-5 days.

CRISPR/cas9 endonuclease-mediated genome editing was used to create a single base substitution at c.3583-9 (G to A) that creates a cryptic splice acceptor site and premature stop codon in intron 16 of the Syngap1 [synaptic Ras GTPase activating protein 1 homolog (rat)] on chromosome 17. The aberrant splicing results in a 7 base pair addition within mRNA transcripts. gRNA (GTACGGGGTCATGTGCCCGG), homology directed repair DNA oligos and cas9 endonuclease were introduced into C57BL/6-EZ-derived one cell stage zygotes. Embryos were transferred to pseudopregnant females, and correctly targeted pups were bred to C57BL/6J mice for germline transmission. The mutation was confirmed by sequencing and Southern blot. Mice were backcrossed to C57BL/6J for at least three generations and then crossed with 129 mice. The colony is maintained as a cross to B6129SF1/J. Upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize B6129SF1/J oocytes.

• Models for Human Disease
• Neurobiology

Araki Y, Gerber EE, Rajkovich KE, Hong I, Johnson RC, Lee HK, Kirkwood A, Huganir RL. Mouse models of SYNGAP1 -related intellectual disability. bioRxiv [Preprint]. 2023 May 26:2023.05.25.542312. doi: 10.1101/2023.05.25.542312. (Medline PMCID: 10245951)