Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Agerem1Xulab/Mmnc
Stock Number:
071380-UNC
Citation ID:
RRID:MMRRC_071380-UNC
Other Names:
RAGE-AHA, AgerAHA

Strain Information

Agerem1Xulab
Name: advanced glycosylation end product-specific receptor; endonuclease-mediated mutation 1, Ding Xu
Synonyms: AgerAHA
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: Knock-In
Ager
Name: advanced glycosylation end product-specific receptor
Synonyms: RAGE
Type: Gene
Species: Mouse
Chromosome: 17
Alteration at locus: Knock-In
NCBI: 11596
HGNC: HGNC:320
Homologene: 883
Genetic Alterations
Targeted substitution in the Ager gene was performed such that arginine codons 214 (CGG), 215 (CGC) and 216 (AGA) in exon 6 were changed to alanine (GCA), histidine (CAT) and alanine (GCT) (p.R214_R216delinsAHA), respectively, using an sgRNA (targeting GGGGCCGCGTCTGGGGACTTGTG) and an ssODN template with CRISPR/Cas9 technology. The mutations in the C1 domain of the encoded peptide render it heparan sulfate (HS)-binding deficient which blocks oligomerization.



Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • ES Cell Line
    Not applicable
    Phenotype
    This mouse strain grows normally without gross morphological abnormalities. It displays increased bone mineral density compared to wild-type mice. Acute inflammatory response to drug-induced liver injury was also found to be dampened in this strain.
    MeSH Terms
    • Animals
    • CHO Cells
    • Cricetinae
    • Cricetulus
    • Heparitin Sulfate/metabolism
    • Humans
    • Mice
    • Mice, Knockout
    • Mice, Transgenic
    • Models, Molecular
    • Osteoblasts
    • Osteoclasts
    • Protein Conformation
    • Receptor for Advanced Glycation End Products/genetics
    • Receptor for Advanced Glycation End Products/metabolism
    Strain Development
    CRISPR guide(s) and Cas9 protein were microinjected into C57BL/6J zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6J breeders (Jackson stock 000664), and derived N1 progeny were identified by PCR and/or sequencing. N1 were then mated again to C57BL/6J breeders to generate N2 mice identified by PCR and/or sequencing. N2 heterozygous mutant mice were mated for production of phenotyping cohorts, and N2 or N2F1 mice were used for cryopreservation purposes.
    Suggested Control Mice
    C57BL/6J
    MMRRC Genetic QC Summary
    The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.
    • Cardiovascular
    • Cell Biology
    • Immunology and Inflammation
    Donor
    Ding Xu, Ph.D., University at Buffalo.
    Primary Reference

    Li M, Ong CY, Langouët-Astrié CJ, Tan L, Verma A, Yang Y, Zhang X, Shah DK, Schmidt EP, Xu D. Heparan sulfate-dependent RAGE oligomerization is indispensable for pathophysiological functions of RAGE. Elife. 2022 Feb 9;11:e71403. doi: 10.7554/eLife.71403. (Medline PMID: 35137686)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    Eye
    Black
    MMRRC Breeding System
    Sib-mating
    Generation
    N/A
    Overall Breeding Performance
    Excellent
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: 7 to 9 months 10 to 12 months
    Bred to Homozygosity
    Yes
    Average litter size
    7 to 9
    Recommended wean age
    3 Weeks
    Average Pups Weaned
    7 to 9

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Esther Eagan.

    A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Esther Eagan

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    071380-UNC-RESUS Litter recovered from cryo-archive $3,088.00 / $5,126.00
    Non-Profit / For-Profit
    Litter Recovered litter4; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.