Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9727Btlr/Mmmh
Stock Number:
069973-MU
Citation ID:
RRID:MMRRC_069973-MU
Other Names:
R9727 (G1)
Major Collection:

Strain Information

Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Lgals8
Name: lectin, galactose binding, soluble 8
Synonyms: Lgals-8, 1200015E08Rik, D13Ertd524e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56048
HGNC: HGNC:6569
Homologene: 31386
Ccn2
Name: cellular communication network factor 2
Synonyms: Hcs24, hypertrophic chondrocyte-specific gene product 24, Fisp12, Ccn2, Ctgf
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14219
HGNC: HGNC:2500
Homologene: 1431
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Kdm3a
Name: lysine (K)-specific demethylase 3A
Synonyms: 1700105C21Rik, Tsga, C230043E16Rik, Jmjd1, Jmjd1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 104263
Homologene: 10196
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Dot1l
Name: DOT1 like histone lysine methyltransferase
Synonyms: mDot1, KMT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208266
Homologene: 32779
Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP-2, nuc, SREBP2, SREBP2gc, bHLHd2, lop13
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 6030449K19Rik, 2900036C23Rik, 2410152H17Rik, 2810413I22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Kif18a
Name: kinesin family member 18A
Synonyms: N-8 kinesin, B130001M12Rik, gcd2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228421
Homologene: 41820
Bub1
Name: BUB1, mitotic checkpoint serine/threonine kinase
Synonyms: Bub1a, D2Xrf87
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12235
HGNC: HGNC:1148
Homologene: 37910
Txnrd3
Name: thioredoxin reductase 3
Synonyms: TR2, Tgr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232223
Homologene: 60033
Gtf2f1
Name: general transcription factor IIF, polypeptide 1
Synonyms: 2810405L04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 98053
VEGA: 17
HGNC: HGNC:4652
Homologene: 1585
Pot1b
Name: protection of telomeres 1B
Synonyms: 2810458H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72836
VEGA: 17
Homologene: 87058
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C130057E09Rik, C030046E11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226089
Homologene: 13806
Emp1
Name: epithelial membrane protein 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13730
HGNC: HGNC:3333
Homologene: 1088
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Ccsap
Name: centriole, cilia and spindle associated protein
Synonyms: 1700054N08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73420
Homologene: 17056
Ccdc187
Name: coiled-coil domain containing 187
Synonyms: 4932418E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329366
Homologene: 77630
Rmdn3
Name: regulator of microtubule dynamics 3
Synonyms: 1200015F23Rik, Fam82a2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67809
Homologene: 34926
Il20rb
Name: interleukin 20 receptor beta
Synonyms: LOC213208, Fndc6, Il20R2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 213208
HGNC: HGNC:6004
Homologene: 86034
Wdr4
Name: WD repeat domain 4
Synonyms: D530049K22Rik, Wh
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57773
Homologene: 32422
Akirin2
Name: akirin 2
Synonyms: 2700059D21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433693
Homologene: 9988
Zfp949
Name: zinc finger protein 949
Synonyms: 4930422I07Rik, Nczf
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71640
Homologene: 129930
Slc7a5
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 5
Synonyms: TA1, D0H16S474E, LAT1, Gm42049
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20539
Homologene: 55759
Trpv1
Name: transient receptor potential cation channel, subfamily V, member 1
Synonyms: capsaicin receptor, VR-1, OTRPC1, Vr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193034
Homologene: 12920
Mtcl2
Name: microtubule crosslinking factor 2
Synonyms: D430036N24Rik, 9830001H06Rik, Soga1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320706
Homologene: 52382
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Rasgrp3
Name: RAS, guanyl releasing protein 3
Synonyms: LOC240168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240168
VEGA: 17
Homologene: 15019
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320051
Homologene: 9007
Mlxipl
Name: MLX interacting protein-like
Synonyms: WS-bHLH, ChREBP, Wbscr14, bHLHd14
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 58805
Homologene: 32507
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Col5a2
Name: collagen, type V, alpha 2
Synonyms: 1110014L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12832
HGNC: HGNC:2210
Homologene: 20119
Rin2
Name: Ras and Rab interactor 2
Synonyms: RASSF4, 4632403N06Rik, 2010003K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74030
Homologene: 32430
Krtap9-5
Name: keratin associated protein 9-5
Synonyms: OTTMUSG00000002205
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 435286
Homologene: 135766
Duox2
Name: dual oxidase 2
Synonyms: A430065P05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214593
Homologene: 9689
Ngef
Name: neuronal guanine nucleotide exchange factor
Synonyms: ephexin, Tims2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53972
HGNC: HGNC:7807
Homologene: 75120
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224079
Homologene: 75330
Atp1a2
Name: ATPase, Na+/K+ transporting, alpha 2 polypeptide
Synonyms: Atpa-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98660
HGNC: HGNC:800
Homologene: 47947
Hid1
Name: HID1 domain containing
Synonyms: C630004H02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217310
Homologene: 12737
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Mvp
Name: major vault protein
Synonyms: VAULT1, LRP, 2310009M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78388
HGNC: HGNC:7531
Homologene: 3752
Arhgef33
Name: Rho guanine nucleotide exchange factor 33
Synonyms: LOC381112, Gm941
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381112
VEGA: 17
Homologene: 55190
Vwa5b2
Name: von Willebrand factor A domain containing 5B2
Synonyms: EG328644
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328643
Homologene: 28056
Ugt2b5
Name: UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms: Udpgt-3, m-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22238
Homologene: 137225
Zbtb34
Name: zinc finger and BTB domain containing 34
Synonyms: LOC241311
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241311
Homologene: 19382
Kif12
Name: kinesin family member 12
Synonyms: N-9 kinesin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16552
Homologene: 7796
Ceacam3
Name: CEA cell adhesion molecule 3
Synonyms: cea12, EG384557, Psg24
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384557
HGNC: HGNC:1819
Homologene: 86971
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Or4f52
Name: olfactory receptor family 4 subfamily F member 52
Synonyms: GA_x6K02T2Q125-72283260-72282322, MOR245-18, Olfr1275
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257980
Homologene: 79419
Cd300ld2
Name: CD300 molecule like family member D2
Synonyms: Gm11709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629970
Slc22a28
Name: solute carrier family 22, member 28
Synonyms: Gm5631
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 434674
VEGA: 19
Homologene: 77136
Ccdc177
Name: coiled-coil domain containing 177
Synonyms: LOC380768, Gm1568
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380768
VEGA: 12
Homologene: 128326
Tmem59
Name: transmembrane protein 59
Synonyms: thymic dendritic cell-derived factor 1, MTDCF1, 3110046P06Rik, 1110001M20Rik, D4Ertd20e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56374
HGNC: HGNC:1239
Homologene: 3583
Zfp607b
Name: zinc finger protein 607B
Synonyms: C030039L03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 112415
Homologene: 134321
Thumpd2
Name: THUMP domain containing 2
Synonyms: 2810025A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72167
VEGA: 17
Homologene: 11898
Ptrh1
Name: peptidyl-tRNA hydrolase 1 homolog
Synonyms: 2210013M04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329384
Homologene: 6135
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to A, chromosome 1 at 34,275,796 bp (GRCm38)
  • A to G, chromosome 1 at 45,376,658 bp (GRCm38)
  • A to G, chromosome 1 at 58,247,314 bp (GRCm38)
  • G to A, chromosome 1 at 87,503,288 bp (GRCm38)
  • T to C, chromosome 1 at 150,798,815 bp (GRCm38)
  • T to A, chromosome 1 at 172,291,369 bp (GRCm38)
  • A to G, chromosome 2 at 26,281,192 bp (GRCm38)
  • T to A, chromosome 2 at 32,775,842 bp (GRCm38)
  • C to A, chromosome 2 at 33,411,521 bp (GRCm38)
  • C to T, chromosome 2 at 109,288,119 bp (GRCm38)
  • A to T, chromosome 2 at 111,231,616 bp (GRCm38)
  • C to A, chromosome 2 at 119,138,346 bp (GRCm38)
  • G to A, chromosome 2 at 122,286,517 bp (GRCm38)
  • T to C, chromosome 2 at 127,810,689 bp (GRCm38)
  • G to A, chromosome 2 at 145,860,586 bp (GRCm38)
  • T to A, chromosome 2 at 157,020,248 bp (GRCm38)
  • A to G, chromosome 4 at 34,565,248 bp (GRCm38)
  • T to A, chromosome 4 at 63,167,741 bp (GRCm38)
  • T to C, chromosome 4 at 91,281,258 bp (GRCm38)
  • G to T, chromosome 4 at 98,987,331 bp (GRCm38)
  • A to G, chromosome 4 at 107,193,350 bp (GRCm38)
  • T to A, chromosome 4 at 139,413,424 bp (GRCm38)
  • T to A, chromosome 5 at 87,140,306 bp (GRCm38)
  • T to A, chromosome 5 at 135,121,534 bp (GRCm38)
  • A to T, chromosome 6 at 71,592,110 bp (GRCm38)
  • A to G, chromosome 6 at 89,674,769 bp (GRCm38)
  • G to T, chromosome 6 at 135,381,018 bp (GRCm38)
  • C to A, chromosome 7 at 17,158,337 bp (GRCm38)
  • T to C, chromosome 7 at 27,703,700 bp (GRCm38)
  • T to A, chromosome 7 at 68,207,806 bp (GRCm38)
  • A to T, chromosome 7 at 126,995,868 bp (GRCm38)
  • A to G, chromosome 8 at 121,886,346 bp (GRCm38)
  • T to C, chromosome 8 at 123,845,430 bp (GRCm38)
  • T to C, chromosome 9 at 21,699,864 bp (GRCm38)
  • A to T, chromosome 9 at 53,376,402 bp (GRCm38)
  • T to A, chromosome 9 at 88,569,860 bp (GRCm38)
  • A to T, chromosome 9 at 100,474,948 bp (GRCm38)
  • A to G, chromosome 10 at 24,595,922 bp (GRCm38)
  • T to C, chromosome 10 at 80,792,548 bp (GRCm38)
  • A to G, chromosome 11 at 55,268,311 bp (GRCm38)
  • A to C, chromosome 11 at 73,239,521 bp (GRCm38)
  • A to G, chromosome 11 at 78,952,999 bp (GRCm38)
  • T to A, chromosome 11 at 99,948,514 bp (GRCm38)
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp (GRCm38)
  • T to G, chromosome 11 at 115,355,113 bp (GRCm38)
  • C to A, chromosome 12 at 80,759,270 bp (GRCm38)
  • T to C, chromosome 12 at 82,425,055 bp (GRCm38)
  • A to T, chromosome 13 at 12,447,157 bp (GRCm38)
  • C to T, chromosome 14 at 26,801,553 bp (GRCm38)
  • A to G, chromosome 15 at 66,615,382 bp (GRCm38)
  • A to T, chromosome 15 at 71,977,274 bp (GRCm38)
  • T to A, chromosome 15 at 82,192,305 bp (GRCm38)
  • C to T, chromosome 15 at 99,273,788 bp (GRCm38)
  • C to T, chromosome 16 at 20,604,727 bp (GRCm38)
  • T to G, chromosome 16 at 29,409,771 bp (GRCm38)
  • A to T, chromosome 16 at 56,169,806 bp (GRCm38)
  • T to C, chromosome 17 at 31,499,071 bp (GRCm38)
  • A to C, chromosome 17 at 55,692,795 bp (GRCm38)
  • A to T, chromosome 17 at 57,011,005 bp (GRCm38)
  • A to G, chromosome 17 at 75,503,244 bp (GRCm38)
  • A to G, chromosome 17 at 80,371,291 bp (GRCm38)
  • A to T, chromosome 17 at 81,038,156 bp (GRCm38)
  • T to A, chromosome 19 at 8,131,454 bp (GRCm38)
  • A to T, chromosome 19 at 29,597,858 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9727 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069973-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.