Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9659Btlr/Mmmh
Stock Number:
069452-MU
Citation ID:
RRID:MMRRC_069452-MU
Other Names:
R9659 (G1)
Major Collection:

Strain Information

Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Ptpn14
Name: protein tyrosine phosphatase, non-receptor type 14
Synonyms: PTP36, C130080N23Rik, OTTMUSG00000022087
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19250
HGNC: HGNC:9647
Homologene: 3941
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Tlk2
Name: tousled-like kinase 2 (Arabidopsis)
Synonyms: protein kinase U-alpha, PKUalpha, 4933403M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 24086
Homologene: 4993
Polr2a
Name: polymerase (RNA) II (DNA directed) polypeptide A
Synonyms: 220kDa, Rpo2-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20020
HGNC: HGNC:9187
Homologene: 721
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: mCD46, Cdc46, Mcmd5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Ccdc14
Name: coiled-coil domain containing 14
Synonyms: G630039H03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239839
VEGA: 16
Homologene: 32549
Trip4
Name: thyroid hormone receptor interactor 4
Synonyms: ASC-1, 4930558E03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56404
Homologene: 9426
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Ep300
Name: E1A binding protein p300
Synonyms: p300, KAT3B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328572
HGNC: HGNC:3373
Homologene: 1094
Or4m1
Name: olfactory receptor family 4 subfamily M member 1
Synonyms: GA_x6K02T2PMLR-6013665-6012724, MOR242-1, Olfr734
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258658
Homologene: 51759
Hpgd
Name: hydroxyprostaglandin dehydrogenase 15 (NAD)
Synonyms: 15-PGDH
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15446
HGNC: HGNC:5154
Homologene: 68095
Elapor1
Name: endosome-lysosome associated apoptosis and autophagy regulator 1
Synonyms: 5330417C22Rik, Inceptor, Iir
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229722
Homologene: 23249
Prpf4
Name: pre-mRNA processing factor 4
Synonyms: 1600015H11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70052
Homologene: 3446
Tmem120b
Name: transmembrane protein 120B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330189
Homologene: 62404
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Cabp1
Name: calcium binding protein 1
Synonyms: caldendrin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 29867
HGNC: HGNC:1384
Homologene: 99790
Nxph1
Name: neurexophilin 1
Synonyms: C130005L03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18231
Homologene: 8284
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zmiz2
Name: zinc finger, MIZ-type containing 2
Synonyms: 2410117E06Rik, D11Bwg0280e, Zimp7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52915
Homologene: 18000
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Gabra2
Name: gamma-aminobutyric acid type A receptor subunit alpha 2
Synonyms: Gabra-2, C630048P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14395
HGNC: HGNC:4076
Homologene: 20217
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Zfand4
Name: zinc finger, AN1-type domain 4
Synonyms: 2810002D23Rik, Anubl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67492
VEGA: 6
Homologene: 18373
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Slc22a26
Name: solute carrier family 22 (organic cation transporter), member 26
Synonyms: BC014805
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 236149
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Ly75
Name: lymphocyte antigen 75
Synonyms: DEC-205, CD205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17076
Homologene: 31085
Cerkl
Name: ceramide kinase-like
Synonyms: Rp26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228094
Homologene: 52396
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Or8g21
Name: olfactory receptor family 8 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-32691280-32690354, MOR171-11, Olfr935
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258741
VEGA: 9
Homologene: 133683
Gfra1
Name: glial cell line derived neurotrophic factor family receptor alpha 1
Synonyms: GDNFR-alpha, GFR alpha-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14585
HGNC: HGNC:4243
Homologene: 3855
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Spata31e5
Name: spermatogenesis associated 31 subfamily E member 5
Synonyms: LOC210962, Gm597
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210962
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Ear2
Name: eosinophil-associated, ribonuclease A family, member 2
Synonyms: eosinophil-derived neurotoxin, liver, Rnase2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13587
Homologene: 40596
Psg16
Name: pregnancy specific beta-1-glycoprotein 16
Synonyms: bCEA, Cea11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26436
Or5p4
Name: olfactory receptor family 5 subfamily P member 4
Synonyms: GA_x6K02T2PBJ9-10409785-10410723, MOR204-2, MOR204-39, Olfr481
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258927
Homologene: 105166
Or10al6
Name: olfactory receptor family 10 subfamily AL member 6
Synonyms: MOR263-10, GA_x6K02T2PSCP-2230932-2231897, Olfr122
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258285
Homologene: 122777
Zfp82
Name: zinc finger protein 82
Synonyms: KRAB16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330502
Homologene: 51177
C2cd2
Name: C2 calcium-dependent domain containing 2
Synonyms: ORF25, 5830404H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207781
VEGA: 16
HGNC: HGNC:1266
Homologene: 18368
Wdr20rt
Name: WD repeat domain 20, retrogene
Synonyms: 4921538B03Rik, 4930427E19Rik, Wdr20b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70948
VEGA: 12
Nr1h4
Name: nuclear receptor subfamily 1, group H, member 4
Synonyms: RIP14, FXR, HRR1, Rxrip14, Fxr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20186
HGNC: HGNC:7967
Homologene: 3760
Ephb4
Name: Eph receptor B4
Synonyms: MDK2, Myk1, Htk, Tyro11, b2b2412Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Kmo
Name: kynurenine 3-monooxygenase
Synonyms: kynurenine 3-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98256
HGNC: HGNC:6381
Homologene: 2729
Mipep
Name: mitochondrial intermediate peptidase
Synonyms: 5730405E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70478
VEGA: 14
HGNC: HGNC:7104
Homologene: 4337
Or1l4
Name: olfactory receptor family 1 subfamily L member 4
Synonyms: GA_x6K02T2NLDC-33885305-33886243, MOR138-1, Olfr365
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258656
Homologene: 74156
A330070K13Rik
Name: RIKEN cDNA A330070K13 gene
Synonyms: LOC381673
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381673
Tcstv2a
Name: 2 cell stage variable group member 2A
Synonyms: clone L4 variable group of 2-cell-stage gene family, clone L8 variable group of 2-cell-stage gene family, AF067061
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 236546
Reg3a
Name: regenerating islet-derived 3 alpha
Synonyms: RegIII (alpha)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19694
HGNC: HGNC:8601
Homologene: 136247
Cited4
Name: Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Synonyms: Mrg2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56222
Homologene: 10474
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 6,248,449 bp (GRCm38)
  • G to T, chromosome 1 at 28,777,455 bp (GRCm38)
  • A to G, chromosome 1 at 121,527,699 bp (GRCm38)
  • T to C, chromosome 1 at 175,658,519 bp (GRCm38)
  • T to A, chromosome 1 at 189,854,977 bp (GRCm38)
  • T to A, chromosome 2 at 37,201,885 bp (GRCm38)
  • C to A, chromosome 2 at 60,338,321 bp (GRCm38)
  • C to T, chromosome 2 at 76,885,013 bp (GRCm38)
  • T to C, chromosome 2 at 79,392,978 bp (GRCm38)
  • T to C, chromosome 2 at 181,240,232 bp (GRCm38)
  • T to C, chromosome 3 at 63,773,715 bp (GRCm38)
  • T to C, chromosome 3 at 64,134,521 bp (GRCm38)
  • G to A, chromosome 3 at 108,469,981 bp (GRCm38)
  • G to A, chromosome 4 at 62,416,059 bp (GRCm38)
  • T to G, chromosome 4 at 120,667,346 bp (GRCm38)
  • T to C, chromosome 5 at 71,034,797 bp (GRCm38)
  • T to C, chromosome 5 at 112,874,516 bp (GRCm38)
  • T to C, chromosome 5 at 115,173,128 bp (GRCm38)
  • T to G, chromosome 5 at 123,115,725 bp (GRCm38)
  • T to C, chromosome 5 at 130,379,035 bp (GRCm38)
  • T to G, chromosome 5 at 137,365,481 bp (GRCm38)
  • A to G, chromosome 6 at 9,247,418 bp (GRCm38)
  • T to G, chromosome 6 at 78,383,591 bp (GRCm38)
  • T to G, chromosome 6 at 116,305,627 bp (GRCm38)
  • T to C, chromosome 7 at 17,090,599 bp (GRCm38)
  • C to T, chromosome 7 at 30,056,538 bp (GRCm38)
  • T to C, chromosome 7 at 108,081,538 bp (GRCm38)
  • T to C, chromosome 7 at 141,645,833 bp (GRCm38)
  • C to G, chromosome 8 at 56,319,040 bp (GRCm38)
  • C to T, chromosome 8 at 75,117,540 bp (GRCm38)
  • A to G, chromosome 8 at 88,319,105 bp (GRCm38)
  • C to A, chromosome 9 at 15,322,550 bp (GRCm38)
  • A to G, chromosome 9 at 38,995,000 bp (GRCm38)
  • T to C, chromosome 9 at 65,833,420 bp (GRCm38)
  • A to C, chromosome 9 at 66,399,903 bp (GRCm38)
  • T to A, chromosome 9 at 105,933,835 bp (GRCm38)
  • C to T, chromosome 10 at 18,165,599 bp (GRCm38)
  • A to G, chromosome 10 at 88,817,309 bp (GRCm38)
  • A to G, chromosome 10 at 89,478,776 bp (GRCm38)
  • A to G, chromosome 11 at 6,396,814 bp (GRCm38)
  • T to C, chromosome 11 at 69,734,828 bp (GRCm38)
  • T to A, chromosome 11 at 71,182,306 bp (GRCm38)
  • G to T, chromosome 11 at 80,089,716 bp (GRCm38)
  • T to C, chromosome 11 at 105,240,437 bp (GRCm38)
  • A to T, chromosome 12 at 65,226,569 bp (GRCm38)
  • A to T, chromosome 13 at 62,371,910 bp (GRCm38)
  • A to G, chromosome 13 at 89,691,741 bp (GRCm38)
  • T to A, chromosome 13 at 120,264,218 bp (GRCm38)
  • A to G, chromosome 14 at 44,103,248 bp (GRCm38)
  • A to G, chromosome 14 at 50,320,724 bp (GRCm38)
  • A to G, chromosome 14 at 60,846,444 bp (GRCm38)
  • A to T, chromosome 15 at 37,984,010 bp (GRCm38)
  • A to G, chromosome 15 at 81,621,072 bp (GRCm38)
  • A to G, chromosome 16 at 34,721,543 bp (GRCm38)
  • A to G, chromosome 16 at 97,922,273 bp (GRCm38)
  • T to G, chromosome 17 at 37,771,989 bp (GRCm38)
  • T to A, chromosome 17 at 84,547,464 bp (GRCm38)
  • C to G, chromosome 18 at 58,209,582 bp (GRCm38)
  • AGAGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGCAGACAGCAGGTGCTCACTGAGGCCTG to AGAGGCCTG, chromosome 18 at 80,089,561 bp (GRCm38)
  • G to A, chromosome 19 at 7,786,433 bp (GRCm38)
  • A to G, chromosome 19 at 17,477,881 bp (GRCm38)
  • A to G, chromosome 19 at 58,453,220 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9659 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069452-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.