Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9537Btlr/Mmmh
Stock Number:
069336-MU
Citation ID:
RRID:MMRRC_069336-MU
Other Names:
R9537 (G1)
Major Collection:

Strain Information

Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Chmp2b
Name: charged multivesicular body protein 2B
Synonyms: 1190006E07Rik, chromatin modifying protein 2B
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68942
VEGA: 16
Homologene: 8534
Mier1
Name: MEIR1 treanscription regulator
Synonyms: 5830411K19Rik, 4933425I22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71148
Homologene: 136176
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Ing1
Name: inhibitor of growth family, member 1
Synonyms: p33Ing1, mING1h, 2610028J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26356
HGNC: HGNC:6062
Homologene: 40119
Mib2
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: 2210008I11Rik, Zzank1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76580
Homologene: 16062
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Smu1
Name: smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms: 2600001O03Rik, SMU-1, 2610203K23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74255
Homologene: 10079
Bnip3l
Name: BCL2/adenovirus E1B interacting protein 3-like
Synonyms: Nix, D14Ertd719e, Nip3L
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12177
HGNC: HGNC:1085
Homologene: 3195
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Adgra3
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70693
Homologene: 19235
Atp5pf
Name: ATP synthase peripheral stalk subunit F6
Synonyms: Atp5j
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11957
HGNC: HGNC:847
Homologene: 1272
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59015
Homologene: 32509
Esyt3
Name: extended synaptotagmin-like protein 3
Synonyms: D9Ertd280e, Fam62c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272636
Homologene: 18626
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Myof
Name: myoferlin
Synonyms: 2310051D19Rik, E030042N20Rik, Fer1l3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226101
VEGA: 19
HGNC: HGNC:3656
Homologene: 40882
Ndst3
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms: 4930511P15Rik, 4921531K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83398
HGNC: HGNC:7682
Homologene: 3513
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Mab21l4
Name: mab-21-like 4
Synonyms: 2310007B03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71874
Homologene: 11761
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Ptgfr
Name: prostaglandin F receptor
Synonyms: PGF, FP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19220
HGNC: HGNC:9600
Homologene: 741
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Dnai1
Name: dynein axonemal intermediate chain 1
Synonyms: 1110066F04Rik, Dnaic1, b2b1526Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68922
HGNC: HGNC:2954
Homologene: 8122
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Chrm3
Name: cholinergic receptor, muscarinic 3, cardiac
Synonyms: M3R, Chrm-3, muscarinic acetylcholine receptor 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12671
HGNC: HGNC:1952
Homologene: 20191
Ttc14
Name: tetratricopeptide repeat domain 14
Synonyms: cI-44, 4931403I22Rik, 4933402I15Rik, 4930434D01Rik, 2700016E08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67120
Homologene: 12085
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22312
Homologene: 129750
D6Ertd527e
Name: DNA segment, Chr 6, ERATO Doi 527, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52372
Hapln2
Name: hyaluronan and proteoglycan link protein 2
Synonyms: 4930401E20Rik, Bral1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73940
Homologene: 11045
Ffar1
Name: free fatty acid receptor 1
Synonyms: Gpr40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233081
HGNC: HGNC:4498
Homologene: 3876
Zfy2
Name: zinc finger protein 2, Y-linked
Synonyms: Zfy-2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22768
Homologene: 56456
Ptgs1
Name: prostaglandin-endoperoxide synthase 1
Synonyms: Cox-1, cyclooxygenase 1, Pghs1, COX1, Cox-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19224
HGNC: HGNC:9604
Homologene: 743
Bglap3
Name: bone gamma-carboxyglutamate protein 3
Synonyms: mOC-X, ORG, Bglap-rs1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12095
HGNC: HGNC:1043
Homologene: 104130
Timm44
Name: translocase of inner mitochondrial membrane 44
Synonyms: Tim44, Mimt44, D8Ertd118e, 0710005E20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21856
Homologene: 4631
Zfp112
Name: zinc finger protein 112
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57745
Homologene: 49338
Bcl2a1d
Name: B cell leukemia/lymphoma 2 related protein A1d
Synonyms: A1-d
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12047
HGNC: HGNC:991
Homologene: 2988
Osgep
Name: O-sialoglycoprotein endopeptidase
Synonyms: 1500019L24Rik, PRSMG1, GCPL-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66246
Homologene: 6395
Litafd
Name: LITAF domain containing
Synonyms: Gm43786, Gm5767
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 436336
Homologene: 80030
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 88,007,395 bp (GRCm38)
  • T to C, chromosome 1 at 93,153,162 bp (GRCm38)
  • G to T, chromosome 2 at 32,288,301 bp (GRCm38)
  • T to C, chromosome 2 at 36,230,727 bp (GRCm38)
  • T to C, chromosome 2 at 90,729,744 bp (GRCm38)
  • A to G, chromosome 3 at 33,803,198 bp (GRCm38)
  • T to A, chromosome 3 at 88,024,473 bp (GRCm38)
  • T to C, chromosome 3 at 88,368,832 bp (GRCm38)
  • A to T, chromosome 3 at 123,671,513 bp (GRCm38)
  • G to T, chromosome 3 at 151,835,808 bp (GRCm38)
  • A to G, chromosome 4 at 40,755,671 bp (GRCm38)
  • A to G, chromosome 4 at 41,629,790 bp (GRCm38)
  • A to T, chromosome 4 at 63,966,584 bp (GRCm38)
  • A to G, chromosome 4 at 103,162,561 bp (GRCm38)
  • A to G, chromosome 4 at 141,471,704 bp (GRCm38)
  • TTGCTGCTGCTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTGCTG, chromosome 4 at 141,516,845 bp (GRCm38)
  • A to T, chromosome 4 at 155,657,495 bp (GRCm38)
  • A to G, chromosome 5 at 49,960,865 bp (GRCm38)
  • A to G, chromosome 5 at 114,387,184 bp (GRCm38)
  • G to C, chromosome 6 at 87,111,857 bp (GRCm38)
  • T to C, chromosome 7 at 24,127,087 bp (GRCm38)
  • T to C, chromosome 7 at 30,860,600 bp (GRCm38)
  • G to T, chromosome 7 at 64,153,868 bp (GRCm38)
  • CGGCGGCGG to CGGCGGCGGGGGCGGCGG, chromosome 7 at 97,579,914 bp (GRCm38)
  • G to A, chromosome 7 at 105,695,533 bp (GRCm38)
  • G to A, chromosome 8 at 4,260,576 bp (GRCm38)
  • T to C, chromosome 8 at 11,561,889 bp (GRCm38)
  • CT to C, chromosome 8 at 104,182,032 bp (GRCm38)
  • T to G, chromosome 9 at 88,731,473 bp (GRCm38)
  • C to T, chromosome 9 at 99,317,239 bp (GRCm38)
  • A to T, chromosome 9 at 108,955,352 bp (GRCm38)
  • T to C, chromosome 11 at 98,171,760 bp (GRCm38)
  • A to T, chromosome 13 at 9,877,426 bp (GRCm38)
  • A to T, chromosome 14 at 50,924,662 bp (GRCm38)
  • G to A, chromosome 14 at 67,008,765 bp (GRCm38)
  • T to C, chromosome 15 at 9,601,799 bp (GRCm38)
  • G to T, chromosome 16 at 8,683,313 bp (GRCm38)
  • T to C, chromosome 16 at 65,551,046 bp (GRCm38)
  • A to G, chromosome 16 at 84,828,470 bp (GRCm38)
  • C to A, chromosome 17 at 20,374,887 bp (GRCm38)
  • A to G, chromosome 19 at 37,907,606 bp (GRCm38)
  • T to A, chromosome Y at 2,108,596 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9537 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069336-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.