Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9518Btlr/Mmmh
Stock Number:
069320-MU
Citation ID:
RRID:MMRRC_069320-MU
Other Names:
R9518 (G1)
Major Collection:

Strain Information

Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: 3010002K18Rik, 2410081F06Rik, Qprs, Eprs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Brpf1
Name: bromodomain and PHD finger containing, 1
Synonyms: 4930540D11Rik, 4833438B11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78783
Homologene: 31251
Dlx6
Name: distal-less homeobox 6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13396
HGNC: HGNC:2919
Homologene: 87855
Mlh3
Name: mutL homolog 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217716
VEGA: 12
HGNC: HGNC:7128
Homologene: 91153
Strn3
Name: striatin, calmodulin binding protein 3
Synonyms: SG2NA
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94186
VEGA: 12
Homologene: 82078
Dpp8
Name: dipeptidylpeptidase 8
Synonyms: 4932434F09Rik, 2310004I03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74388
VEGA: 9
Homologene: 57098
Pgr
Name: progesterone receptor
Synonyms: NR3C3, PR, 9930019P03Rik, PR-B, PR-A, ENSMUSG00000074510
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18667
HGNC: HGNC:8910
Homologene: 713
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Tent2
Name: terminal nucleotidyltransferase 2
Synonyms: 8030446C20Rik, Papd4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100715
VEGA: 13
Homologene: 44022
Etnk1
Name: ethanolamine kinase 1
Synonyms: 1110061E11Rik, EKI1, 4930555L11Rik, D6Ertd3e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75320
Homologene: 10240
Themis
Name: thymocyte selection associated
Synonyms: E430004N04Rik, Tsepa, Gasp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210757
Homologene: 72287
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Abcf2
Name: ATP-binding cassette, sub-family F member 2
Synonyms: 0710005O05Rik, Drr3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27407
Homologene: 21408
Vac14
Name: Vac14 homolog (S. cerevisiae)
Synonyms: Trx, Tax1bp2, D8Wsu151e, ingls
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234729
Homologene: 6528
Kel
Name: Kell blood group
Synonyms: CD238
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23925
HGNC: HGNC:6308
Homologene: 362
Mgat5b
Name: mannoside acetylglucosaminyltransferase 5, isoenzyme B
Synonyms: GnT-IX
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268510
Homologene: 27821
Map4k1
Name: mitogen-activated protein kinase kinase kinase kinase 1
Synonyms: Hpk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26411
HGNC: HGNC:6863
Homologene: 5199
Fam124a
Name: family with sequence similarity 124, member A
Synonyms: EG629059
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 629059
Homologene: 86241
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Brd10
Name: bromodomain containing 10
Synonyms: Gm9832, 9930021J03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240613
Homologene: 19046
Egflam
Name: EGF-like, fibronectin type III and laminin G domains
Synonyms: nectican, pikachurin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268780
Homologene: 65044
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Or13p3
Name: olfactory receptor family 13 subfamily P member 3
Synonyms: GA_x6K02T2QD9B-18838170-18837232, MOR258-1, Olfr1341
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258852
Homologene: 27281
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666528
Homologene: 12991
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPS, CPSase I, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Trim28
Name: tripartite motif-containing 28
Synonyms: KRIP-1, KAP-1, Tif1b, MommeD9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21849
Homologene: 21175
Ces5a
Name: carboxylesterase 5A
Synonyms: LOC244598, 1700081L16Rik, 1700122C07Rik, cauxin, Ces7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67935
Homologene: 74305
Ccdc178
Name: coiled coil domain containing 178
Synonyms: 4921528I01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70950
VEGA: 18
Homologene: 12373
Grm8
Name: glutamate receptor, metabotropic 8
Synonyms: mGluR8, Gprc1h
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14823
HGNC: HGNC:4600
Homologene: 654
Mettl14
Name: methyltransferase 14, N6-adenosine-methyltransferase subunit
Synonyms: G430022H21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 210529
Homologene: 10865
Serpinb3c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms: 1110001H02Rik, 1110013A16Rik, ovalbumin, Serpinb4, Scca2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381286
Homologene: 131278
Or11h7
Name: olfactory receptor family 11 subfamily H member 7
Synonyms: GA_x6K02T2PMLR-6372116-6373060, MOR106-12, Olfr746
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258295
Homologene: 134081
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Ccdc62
Name: coiled-coil domain containing 62
Synonyms: LOC208908, G1-485-3, repro29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208908
Homologene: 82466
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm29096, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Fstl4
Name: follistatin-like 4
Synonyms: B230374F23Rik, SPIG1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320027
Homologene: 18543
Dvl3
Name: dishevelled segment polarity protein 3
Synonyms: b2b2866Clo
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13544
HGNC: HGNC:3087
Homologene: 20928
Mtcl3
Name: MTCL family member 3
Synonyms: 6330407J23Rik, Soga3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67412
VEGA: 10
Homologene: 28227
Tgm2
Name: transglutaminase 2, C polypeptide
Synonyms: tissue transglutaminase, protein-glutamine gamma-glutamyltransferase, G[a]h, TG C, tTGas, tTG, TG2, TGase2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21817
Homologene: 3391
Desi2
Name: desumoylating isopeptidase 2
Synonyms: 5830417C01Rik, Fam152a, Pppde1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78825
Homologene: 56741
Vwa1
Name: von Willebrand factor A domain containing 1
Synonyms: WARP, 4932416A11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246228
Homologene: 11270
B230104I21Rik
Name: RIKEN cDNA B230104I21 gene
Type: Gene
Species: Mouse
Chromosome: 4
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 67,220,503 bp (GRCm38)
  • T to A, chromosome 1 at 107,272,738 bp (GRCm38)
  • A to G, chromosome 1 at 178,187,926 bp (GRCm38)
  • A to T, chromosome 1 at 185,379,566 bp (GRCm38)
  • C to T, chromosome 2 at 158,143,129 bp (GRCm38)
  • T to C, chromosome 3 at 123,374,038 bp (GRCm38)
  • A to G, chromosome 4 at 118,709,923 bp (GRCm38)
  • T to C, chromosome 4 at 143,134,009 bp (GRCm38)
  • G to T, chromosome 4 at 154,349,547 bp (GRCm38)
  • G to A, chromosome 4 at 155,772,879 bp (GRCm38)
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp (GRCm38)
  • T to C, chromosome 5 at 24,566,562 bp (GRCm38)
  • A to T, chromosome 5 at 57,913,171 bp (GRCm38)
  • T to C, chromosome 5 at 114,359,527 bp (GRCm38)
  • T to A, chromosome 5 at 123,951,225 bp (GRCm38)
  • C to A, chromosome 6 at 6,863,406 bp (GRCm38)
  • T to A, chromosome 6 at 27,429,470 bp (GRCm38)
  • T to C, chromosome 6 at 41,702,400 bp (GRCm38)
  • A to G, chromosome 6 at 113,309,834 bp (GRCm38)
  • A to T, chromosome 6 at 143,203,418 bp (GRCm38)
  • T to C, chromosome 7 at 6,711,281 bp (GRCm38)
  • C to T, chromosome 7 at 13,030,518 bp (GRCm38)
  • T to C, chromosome 7 at 16,079,111 bp (GRCm38)
  • G to A, chromosome 7 at 28,994,071 bp (GRCm38)
  • A to G, chromosome 7 at 139,939,914 bp (GRCm38)
  • T to C, chromosome 8 at 93,530,802 bp (GRCm38)
  • C to T, chromosome 8 at 110,715,438 bp (GRCm38)
  • A to T, chromosome 9 at 8,922,644 bp (GRCm38)
  • T to C, chromosome 9 at 65,074,584 bp (GRCm38)
  • T to A, chromosome 10 at 28,668,752 bp (GRCm38)
  • T to A, chromosome 10 at 29,146,752 bp (GRCm38)
  • T to A, chromosome 10 at 41,589,576 bp (GRCm38)
  • A to G, chromosome 11 at 53,165,820 bp (GRCm38)
  • T to C, chromosome 11 at 75,503,660 bp (GRCm38)
  • A to G, chromosome 11 at 116,978,473 bp (GRCm38)
  • A to C, chromosome 12 at 51,650,173 bp (GRCm38)
  • C to T, chromosome 12 at 85,266,230 bp (GRCm38)
  • A to G, chromosome 13 at 93,184,104 bp (GRCm38)
  • A to T, chromosome 13 at 100,221,859 bp (GRCm38)
  • A to C, chromosome 14 at 26,773,756 bp (GRCm38)
  • A to T, chromosome 14 at 50,653,644 bp (GRCm38)
  • A to C, chromosome 14 at 62,587,498 bp (GRCm38)
  • A to G, chromosome 15 at 7,289,782 bp (GRCm38)
  • G to A, chromosome 15 at 80,387,777 bp (GRCm38)
  • A to G, chromosome 15 at 90,956,473 bp (GRCm38)
  • T to A, chromosome 16 at 20,517,211 bp (GRCm38)
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp (GRCm38)
  • G to A, chromosome 18 at 22,145,459 bp (GRCm38)
  • A to T, chromosome 19 at 29,754,141 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9518 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069320-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.