Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9396Btlr/Mmmh
Stock Number:
069200-MU
Citation ID:
RRID:MMRRC_069200-MU
Other Names:
R9396 (G1)
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Mapt
Name: microtubule-associated protein tau
Synonyms: Mtapt, Tau
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17762
HGNC: HGNC:6893
Homologene: 74962
Csrnp3
Name: cysteine-serine-rich nuclear protein 3
Synonyms: mbu1, A330102K23Rik, CSRNP-3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77771
Homologene: 11803
Cdk5rap2
Name: CDK5 regulatory subunit associated protein 2
Synonyms: 2900018K03Rik, an
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214444
Homologene: 49533
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Sin3a
Name: transcriptional regulator, SIN3A (yeast)
Synonyms: Sin3, mSin3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20466
Homologene: 32124
Abcg8
Name: ATP binding cassette subfamily G member 8
Synonyms: 1300003C16Rik, Sterolin-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67470
Homologene: 23361
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, 2610108D09Rik, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Nuf2
Name: NUF2, NDC80 kinetochore complex component
Synonyms: 2410003C07Rik, Nuf2R, Cdca1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66977
Homologene: 40205
Ibsp
Name: integrin binding sialoprotein
Synonyms: BSP, bone sialoprotein, Bsp2, Bsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15891
HGNC: HGNC:5341
Homologene: 3644
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Tcf25
Name: transcription factor 25 (basic helix-loop-helix)
Synonyms: 1810041K11Rik, 1100001J13Rik, Nulp1, D8Ertd325e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66855
Homologene: 5701
Tm7sf3
Name: transmembrane 7 superfamily member 3
Synonyms: 2010003B14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67623
Homologene: 9560
Zfp949
Name: zinc finger protein 949
Synonyms: 4930422I07Rik, Nczf
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71640
Homologene: 129930
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214764
Homologene: 27985
Slc15a4
Name: solute carrier family 15, member 4
Synonyms: C130069N12Rik, PTR4, PHT1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100561
Homologene: 26432
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Rasgef1b
Name: RasGEF domain family, member 1B
Synonyms: Gpig4, 4732452O09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320292
Homologene: 14860
Myof
Name: myoferlin
Synonyms: 2310051D19Rik, E030042N20Rik, Fer1l3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226101
VEGA: 19
HGNC: HGNC:3656
Homologene: 40882
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Nhsl1
Name: NHS like 1
Synonyms: A630035H13Rik, D10Bwg0940e, 5730409E15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215819
Homologene: 27834
Gas2l2
Name: growth arrest-specific 2 like 2
Synonyms: OTTMUSG00000000934
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237891
Homologene: 16409
Cadm2
Name: cell adhesion molecule 2
Synonyms: A830029E02Rik, Necl3, SynCAM2, Igsf4d, 2900078E11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239857
Homologene: 17705
Or5k3
Name: olfactory receptor family 5 subfamily K member 3
Synonyms: GA_x54KRFPKG5P-55369823-55370749, MOR184-5, Olfr195
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259000
Homologene: 128109
Tbx18
Name: T-box18
Synonyms: 2810012F10Rik, 2810404D13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76365
Homologene: 11384
Ndor1
Name: NADPH dependent diflavin oxidoreductase 1
Synonyms: NR1, 4930447P04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78797
Homologene: 7144
Cckar
Name: cholecystokinin A receptor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12425
HGNC: HGNC:1570
Homologene: 37337
Or1d2
Name: olfactory receptor family 1 subfamily D member 2
Synonyms: GA_x6K02T2P1NL-4500587-4501525, MOR127-5P, Olfr412
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258153
Homologene: 37634
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Or2n1
Name: olfactory receptor family 2 subfamily N member 1
Synonyms: MOR256-5, GA_x6K02T2PSCP-2623613-2624551, Olfr134
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258829
Homologene: 110603
Nubp2
Name: nucleotide binding protein 2
Synonyms: D17Wsu11e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26426
VEGA: 17
HGNC: HGNC:8042
Homologene: 8057
Smarca5
Name: SNF2 related chromatin remodeling ATPase 5
Synonyms: Snf2h, D330027N15Rik, 4933427E24Rik, D030040M08Rik, MommeD4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93762
Homologene: 55764
Rnf180
Name: ring finger protein 180
Synonyms: 3110001E11Rik, Rines
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71816
VEGA: 13
Homologene: 18677
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242702
Homologene: 19432
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Evc
Name: EvC ciliary complex subunit 1
Synonyms: Ellis van Creveld gene syndrome
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59056
HGNC: HGNC:3497
Homologene: 10949
Fcgr1
Name: Fc receptor, IgG, high affinity I
Synonyms: CD64, FcgammaRI
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14129
Homologene: 475
Slc2a13
Name: solute carrier family 2 (facilitated glucose transporter), member 13
Synonyms: A630029G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239606
Homologene: 43139
Or8k28
Name: olfactory receptor family 8 subfamily K member 28
Synonyms: GA_x6K02T2Q125-47925557-47924616, MOR188-8, MOR256-52P, Olfr1066
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257880
Homologene: 79468
Fstl4
Name: follistatin-like 4
Synonyms: B230374F23Rik, SPIG1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320027
Homologene: 18543
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: A430041B07Rik, Fam179b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328108
VEGA: 12
Homologene: 15025
Kcnc3
Name: potassium voltage gated channel, Shaw-related subfamily, member 3
Synonyms: Kv3.3, KShIIID, Kcr2-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16504
HGNC: HGNC:6235
Homologene: 3650
Apol7a
Name: apolipoprotein L 7a
Synonyms: 9130022K13Rik, Apol3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75761
HGNC: HGNC:619
Homologene: 40940
Ifitm10
Name: interferon induced transmembrane protein 10
Synonyms: 6330512M04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320802
Cd300ld
Name: CD300 molecule like family member d
Synonyms: Clm5, MAIR-IV, 4732429D16Rik, Cd300ld1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217305
Homologene: 129719
Or55b4
Name: olfactory receptor family 55 subfamily B member 4
Synonyms: GA_x6K02T2PBJ9-5206624-5205620, MOR42-3, Olfr544
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257926
Homologene: 133590
Pskh1
Name: protein serine kinase H1
Synonyms: E130013P03Rik, b2b1230Clo
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244631
HGNC: HGNC:9529
Homologene: 48461
Klhl3
Name: kelch-like 3
Synonyms: 7530408C15Rik, EG627648
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100503085
HGNC: HGNC:6354
Homologene: 79542
Or4k42
Name: olfactory receptor family 4 subfamily K member 42
Synonyms: GA_x6K02T2Q125-72541649-72540711, MOR248-9, Olfr1290
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257662
Homologene: 74248
Acad8
Name: acyl-Coenzyme A dehydrogenase family, member 8
Synonyms: 2310016C19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66948
HGNC: HGNC:87
Homologene: 8662
Pals1
Name: protein associated with LIN7 1, MAGUK family member
Synonyms: Pals1, 3830420B02Rik, Mpp5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56217
VEGA: 12
Homologene: 9512
Or51i2
Name: olfactory receptor family 51 subfamily I member 2
Synonyms: GA_x6K02T2PBJ9-6773690-6774628, MOR13-3, Olfr641
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259075
Homologene: 17489
Nalf2
Name: NALCN channel auxiliary factor 2
Synonyms: EG620592, Fam155b, Tmem28
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 620592
Homologene: 83276
Dusp2
Name: dual specificity phosphatase 2
Synonyms: PAC1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13537
HGNC: HGNC:3068
Homologene: 3255
Asmt
Name: acetylserotonin O-methyltransferase
Synonyms: Hiomt
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 107626
VEGA: X
HGNC: HGNC:750
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 169,510,348 bp (GRCm38)
  • A to G, chromosome 2 at 25,248,909 bp (GRCm38)
  • G to T, chromosome 2 at 35,037,603 bp (GRCm38)
  • C to T, chromosome 2 at 66,002,497 bp (GRCm38)
  • A to T, chromosome 2 at 86,455,501 bp (GRCm38)
  • A to G, chromosome 2 at 111,489,519 bp (GRCm38)
  • C to T, chromosome 2 at 127,337,718 bp (GRCm38)
  • T to A, chromosome 3 at 96,287,074 bp (GRCm38)
  • A to G, chromosome 4 at 70,254,666 bp (GRCm38)
  • C to T, chromosome 4 at 70,264,658 bp (GRCm38)
  • G to T, chromosome 4 at 135,785,888 bp (GRCm38)
  • T to C, chromosome 5 at 37,319,090 bp (GRCm38)
  • G to A, chromosome 5 at 53,707,281 bp (GRCm38)
  • T to C, chromosome 5 at 99,229,329 bp (GRCm38)
  • A to G, chromosome 5 at 104,310,431 bp (GRCm38)
  • A to G, chromosome 5 at 127,617,399 bp (GRCm38)
  • T to C, chromosome 6 at 146,621,974 bp (GRCm38)
  • T to C, chromosome 7 at 44,591,513 bp (GRCm38)
  • G to A, chromosome 7 at 102,415,385 bp (GRCm38)
  • A to C, chromosome 7 at 102,484,973 bp (GRCm38)
  • A to G, chromosome 7 at 104,040,513 bp (GRCm38)
  • A to G, chromosome 7 at 118,208,080 bp (GRCm38)
  • A to G, chromosome 7 at 133,660,109 bp (GRCm38)
  • A to T, chromosome 7 at 142,370,967 bp (GRCm38)
  • T to C, chromosome 8 at 80,736,729 bp (GRCm38)
  • C to T, chromosome 8 at 105,913,459 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • A to G, chromosome 8 at 123,401,092 bp (GRCm38)
  • A to G, chromosome 9 at 26,975,745 bp (GRCm38)
  • A to G, chromosome 9 at 57,101,161 bp (GRCm38)
  • T to C, chromosome 9 at 87,727,379 bp (GRCm38)
  • T to C, chromosome 9 at 88,567,207 bp (GRCm38)
  • A to C, chromosome 9 at 122,852,516 bp (GRCm38)
  • T to A, chromosome 10 at 18,524,001 bp (GRCm38)
  • A to G, chromosome 10 at 108,264,710 bp (GRCm38)
  • C to A, chromosome 11 at 52,773,951 bp (GRCm38)
  • T to A, chromosome 11 at 74,365,263 bp (GRCm38)
  • A to T, chromosome 11 at 83,422,833 bp (GRCm38)
  • C to A, chromosome 11 at 104,298,729 bp (GRCm38)
  • G to A, chromosome 11 at 114,987,404 bp (GRCm38)
  • A to G, chromosome 11 at 116,075,703 bp (GRCm38)
  • A to G, chromosome 12 at 64,967,655 bp (GRCm38)
  • G to T, chromosome 12 at 78,824,747 bp (GRCm38)
  • T to G, chromosome 13 at 58,013,848 bp (GRCm38)
  • T to A, chromosome 13 at 105,181,519 bp (GRCm38)
  • T to C, chromosome 15 at 77,389,725 bp (GRCm38)
  • T to C, chromosome 15 at 77,763,296 bp (GRCm38)
  • T to C, chromosome 15 at 91,343,712 bp (GRCm38)
  • G to A, chromosome 16 at 59,148,939 bp (GRCm38)
  • T to C, chromosome 16 at 66,747,216 bp (GRCm38)
  • C to T, chromosome 17 at 24,884,502 bp (GRCm38)
  • T to A, chromosome 17 at 38,175,530 bp (GRCm38)
  • T to A, chromosome 17 at 84,692,854 bp (GRCm38)
  • T to A, chromosome 18 at 20,041,716 bp (GRCm38)
  • C to T, chromosome 18 at 62,922,660 bp (GRCm38)
  • A to T, chromosome 19 at 37,934,846 bp (GRCm38)
  • C to T, chromosome X at 99,845,491 bp (GRCm38)
  • A to G, chromosome X at 170,676,406 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9396 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069200-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.