Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9389Btlr/Mmmh
Stock Number:
069195-MU
Citation ID:
RRID:MMRRC_069195-MU
Other Names:
R9389 (G1)
Major Collection:

Strain Information

Il4
Name: interleukin 4
Synonyms: Il-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16189
HGNC: HGNC:6014
Homologene: 491
Runx1
Name: runt related transcription factor 1
Synonyms: AML1, Pebp2a2, runt domain, alpha subunit 2, Cbfa2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12394
Homologene: 1331
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Oxtr
Name: oxytocin receptor
Synonyms: OTR
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18430
HGNC: HGNC:8529
Homologene: 20255
Rfesd
Name: Rieske (Fe-S) domain containing
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218341
VEGA: 13
Homologene: 18282
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: mZ13, Miz1, Zfp100
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22642
Homologene: 2575
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Jak3
Name: Janus kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16453
HGNC: HGNC:6193
Homologene: 181
Itgb1
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: CD29, beta1 integrin, 4633401G24Rik, Fnrb, Gm9863
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16412
HGNC: HGNC:6153
Homologene: 22999
Baz1a
Name: bromodomain adjacent to zinc finger domain 1A
Synonyms: Gtl5, Wcrf180, Acf1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217578
HGNC: HGNC:960
Homologene: 45654
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Itpr-3, Ip3r3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Agtpbp1
Name: ATP/GTP binding protein 1
Synonyms: Nna1, 2900054O13Rik, 4930445M19Rik, 1700020N17Rik, 5730402G09Rik, 2310001G17Rik, Ccp1, atms
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67269
Homologene: 9067
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Col9a2
Name: collagen, type IX, alpha 2
Synonyms: Col9a-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12840
HGNC: HGNC:2218
Homologene: 37535
Mrm3
Name: mitochondrial rRNA methyltransferase 3
Synonyms: HC90, 4833420N02Rik, Rnmtl1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67390
Homologene: 10033
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Cfap53
Name: cilia and flagella associated protein 53
Synonyms: 4933415I03Rik, Ccdc11
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74453
Homologene: 27056
Ces1f
Name: carboxylesterase 1F
Synonyms: TGH-2, CesML1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234564
HGNC: HGNC:1863
Homologene: 134311
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAG1, IGFBP-4ase, PAPP-A, 8430414N03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Or13p3
Name: olfactory receptor family 13 subfamily P member 3
Synonyms: GA_x6K02T2QD9B-18838170-18837232, MOR258-1, Olfr1341
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258852
Homologene: 27281
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Pip4k2a
Name: phosphatidylinositol-5-phosphate 4-kinase, type II, alpha
Synonyms: Pip5k2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18718
HGNC: HGNC:8997
Homologene: 37995
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Sema5b
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B
Synonyms: SemG, SemG, Semag
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20357
Homologene: 8427
Or4f57
Name: olfactory receptor family 4 subfamily F member 57
Synonyms: GA_x6K02T2Q125-73008844-73007882, MOR245-22, Olfr1308
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258258
Homologene: 45797
Or5k14
Name: olfactory receptor family 5 subfamily K member 14
Synonyms: GA_x54KRFPKG5P-55091371-55090442, MOR184-7, Olfr177, MOR184-8, GA_x54KRFPKG5P-55043245-55042289, Olfr176
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258998
Homologene: 121500
Ranbp3l
Name: RAN binding protein 3-like
Synonyms: C130037N17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223332
VEGA: 15
Homologene: 35407
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Wdr27
Name: WD repeat domain 27
Synonyms: 0610012K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71682
VEGA: 17
Homologene: 18417
Elmo1
Name: engulfment and cell motility 1
Synonyms: CED-12, C230095H21Rik, 6330578D22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 140580
Homologene: 56685
Mfsd11
Name: major facilitator superfamily domain containing 11
Synonyms: 2600014M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69900
Homologene: 11517
Prss3b
Name: serine protease 3B
Synonyms: 2210010C04Rik, T7, cationic trypsinogen (isoform T7)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67373
Homologene: 134055
Fem1al
Name: fem-1 homolog A like
Synonyms: 4931440F15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216622
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Or12j3
Name: olfactory receptor family 12 subfamily J member 3
Synonyms: GA_x6K02T2PBJ9-42523824-42522901, MOR252-2, Olfr530
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258512
Homologene: 128384
Or5aq6
Name: olfactory receptor family 5 subfamily AQ member 6
Synonyms: GA_x6K02T2Q125-48586461-48585523, MOR172-5, Olfr1109
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258762
Homologene: 86672
Myg1
Name: melanocyte proliferating gene 1
Synonyms: Gamm1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 60315
Homologene: 5853
Npy6r
Name: neuropeptide Y receptor Y6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18169
VEGA: 18
HGNC: HGNC:7959
Homologene: 134692
Tgm2
Name: transglutaminase 2, C polypeptide
Synonyms: tissue transglutaminase, protein-glutamine gamma-glutamyltransferase, G[a]h, TG C, tTGas, tTG, TG2, TGase2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21817
Homologene: 3391
Pla2g4f
Name: phospholipase A2, group IVF
Synonyms: 4732472I07Rik, Pla2zeta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271844
Homologene: 77933
Or6c215
Name: olfactory receptor family 6 subfamily C member 215
Synonyms: GA_x6K02T2PULF-11481207-11480248, MOR110-6, Olfr811
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258545
Homologene: 133725
Igfals
Name: insulin-like growth factor binding protein, acid labile subunit
Synonyms: ALS, Albs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16005
VEGA: 17
HGNC: HGNC:5468
Homologene: 37987
Gpr162
Name: G protein-coupled receptor 162
Synonyms: A-2, Grca
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14788
Homologene: 8400
Dusp6
Name: dual specificity phosphatase 6
Synonyms: 1300019I03Rik, MKP3, PYST1, MKP-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67603
VEGA: 10
HGNC: HGNC:3072
Homologene: 55621
Vmn1r88
Name: vomeronasal 1 receptor, 88
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100312474
Homologene: 74345
Ppp1r35
Name: protein phosphatase 1, regulatory subunit 35
Synonyms: 2010011D20Rik, 2010007H12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69871
Homologene: 12337
Gm19965
Name: predicted gene, 19965
Type: Gene
Species: Mouse
Chromosome: 1
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to G, chromosome 1 at 116,821,836 bp (GRCm38)
  • A to G, chromosome 1 at 131,355,627 bp (GRCm38)
  • A to T, chromosome 2 at 15,703,156 bp (GRCm38)
  • T to C, chromosome 2 at 18,908,079 bp (GRCm38)
  • A to T, chromosome 2 at 44,997,908 bp (GRCm38)
  • A to T, chromosome 2 at 87,093,046 bp (GRCm38)
  • G to T, chromosome 2 at 111,960,527 bp (GRCm38)
  • T to A, chromosome 2 at 120,302,300 bp (GRCm38)
  • T to C, chromosome 2 at 158,117,896 bp (GRCm38)
  • CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCATCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA to CCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGCATTTCTAAGACCACCACTGGGGTTTCTAAGATCACCACTGGTGTTTCTAAGACCACCACTGGCATTTCTAAGACCA, chromosome 3 at 105,986,525 bp (GRCm38)
  • A to T, chromosome 4 at 65,180,888 bp (GRCm38)
  • C to A, chromosome 4 at 118,236,039 bp (GRCm38)
  • A to T, chromosome 4 at 118,710,156 bp (GRCm38)
  • A to G, chromosome 4 at 121,054,751 bp (GRCm38)
  • A to G, chromosome 4 at 139,425,924 bp (GRCm38)
  • G to A, chromosome 4 at 141,465,820 bp (GRCm38)
  • G to A, chromosome 5 at 8,825,614 bp (GRCm38)
  • T to A, chromosome 5 at 137,779,315 bp (GRCm38)
  • C to T, chromosome 6 at 41,033,145 bp (GRCm38)
  • C to A, chromosome 6 at 112,489,349 bp (GRCm38)
  • A to G, chromosome 6 at 124,861,394 bp (GRCm38)
  • T to C, chromosome 7 at 13,178,619 bp (GRCm38)
  • T to G, chromosome 7 at 127,542,283 bp (GRCm38)
  • T to C, chromosome 7 at 140,373,017 bp (GRCm38)
  • C to T, chromosome 8 at 71,684,052 bp (GRCm38)
  • A to T, chromosome 8 at 93,269,972 bp (GRCm38)
  • T to A, chromosome 8 at 128,707,156 bp (GRCm38)
  • T to C, chromosome 9 at 106,000,784 bp (GRCm38)
  • T to C, chromosome 10 at 5,229,193 bp (GRCm38)
  • A to G, chromosome 10 at 18,603,523 bp (GRCm38)
  • T to A, chromosome 10 at 39,822,971 bp (GRCm38)
  • G to A, chromosome 10 at 99,263,977 bp (GRCm38)
  • G to A, chromosome 10 at 129,801,671 bp (GRCm38)
  • A to G, chromosome 11 at 29,825,107 bp (GRCm38)
  • C to T, chromosome 11 at 53,614,010 bp (GRCm38)
  • A to G, chromosome 11 at 76,250,030 bp (GRCm38)
  • T to G, chromosome 11 at 116,873,335 bp (GRCm38)
  • T to A, chromosome 12 at 54,916,823 bp (GRCm38)
  • T to G, chromosome 13 at 20,185,491 bp (GRCm38)
  • A to T, chromosome 13 at 59,466,070 bp (GRCm38)
  • T to C, chromosome 13 at 76,003,012 bp (GRCm38)
  • A to G, chromosome 13 at 76,127,039 bp (GRCm38)
  • T to A, chromosome 13 at 100,219,830 bp (GRCm38)
  • C to A, chromosome 13 at 103,333,930 bp (GRCm38)
  • T to A, chromosome 15 at 9,057,223 bp (GRCm38)
  • A to T, chromosome 15 at 9,725,221 bp (GRCm38)
  • T to A, chromosome 15 at 66,689,324 bp (GRCm38)
  • G to T, chromosome 15 at 102,336,937 bp (GRCm38)
  • A to C, chromosome 16 at 35,645,722 bp (GRCm38)
  • C to T, chromosome 16 at 58,872,613 bp (GRCm38)
  • C to T, chromosome 16 at 92,613,680 bp (GRCm38)
  • A to G, chromosome 17 at 14,891,718 bp (GRCm38)
  • G to A, chromosome 17 at 24,881,626 bp (GRCm38)
  • A to T, chromosome 17 at 27,095,925 bp (GRCm38)
  • T to A, chromosome 18 at 5,090,811 bp (GRCm38)
  • T to C, chromosome 18 at 44,275,692 bp (GRCm38)
  • T to A, chromosome 18 at 74,299,343 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9389 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069195-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.