Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9249Btlr/Mmmh
Stock Number:
069074-MU
Citation ID:
RRID:MMRRC_069074-MU
Other Names:
R9249 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Arfgef2
Name: ARF guanine nucleotide exchange factor 2
Synonyms: BIG2, E230011G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99371
Homologene: 111880
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Pcbp3
Name: poly(rC) binding protein 3
Synonyms: AlphaCP-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59093
HGNC: HGNC:8651
Homologene: 23233
Papola
Name: poly (A) polymerase alpha
Synonyms: Plap, PapIII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18789
Homologene: 23389
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Nvl
Name: nuclear VCP-like
Synonyms: 1200009I24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67459
HGNC: HGNC:8070
Homologene: 1902
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Slc8a2
Name: solute carrier family 8 (sodium/calcium exchanger), member 2
Synonyms: Ncx2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 110891
Homologene: 27358
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Stard5
Name: StAR related lipid transfer domain containing 5
Synonyms: 18B7-T7(GS), 2310058G22Rik, D7Ertd152e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170460
Homologene: 11346
Chpf2
Name: chondroitin polymerizing factor 2
Synonyms: 2010209O12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100910
Homologene: 14763
Egfl8
Name: EGF-like domain 8
Synonyms: NG3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81701
Homologene: 36473
Gdpd5
Name: glycerophosphodiester phosphodiesterase domain containing 5
Synonyms: Gde2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233552
Homologene: 32741
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKK-beta, IKK-2, IKK2, IKK[b], IKKbeta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Sec31a
Name: SEC31 homolog A, COPII coat complex component
Synonyms: 1810024J13Rik, Sec31l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69162
Homologene: 42056
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Ric3
Name: RIC3 acetylcholine receptor chaperone
Synonyms: E130307J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320360
Homologene: 49772
Nphs2
Name: nephrosis 2, podocin
Synonyms: podocin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170484
Homologene: 22826
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cchl1a1, Cav1.2, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Zfp458
Name: zinc finger protein 458
Synonyms: Rslcan-7
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238690
VEGA: 13
Homologene: 128170
Ppfia2
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms: E130120L08Rik, Liprin-alpha2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327814
VEGA: 10
HGNC: HGNC:9246
Homologene: 27953
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Cntn4
Name: contactin 4
Synonyms: BIG-2A, Axcam
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269784
HGNC: HGNC:2174
Homologene: 14257
Spata16
Name: spermatogenesis associated 16
Synonyms: spermatogenesis-related protein, Nyd-sp12, 4930503K02Rik, 4921511F01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70862
Homologene: 49974
Or1j14
Name: olfactory receptor family 1 subfamily J member 14
Synonyms: GA_x6K02T2NLDC-33222024-33222962, MOR136-4, Olfr342
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258950
Homologene: 74223
Serpina3i
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3I
Synonyms: 2B2, antitrypsin, alpha-1 antiproteinase, Gm6930
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 628900
HGNC: HGNC:16
Homologene: 115927
Itga1
Name: integrin alpha 1
Synonyms: CD49A, Vla1, E130012M19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109700
VEGA: 13
HGNC: HGNC:6134
Homologene: 57137
Abca5
Name: ATP-binding cassette, sub-family A member 5
Synonyms: ABC13, B930033A02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217265
HGNC: HGNC:35
Homologene: 10263
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Slc6a20a
Name: solute carrier family 6 (neurotransmitter transporter), member 20A
Synonyms: A730081N20Rik, Xtrp3s1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102680
Homologene: 10625
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Myot
Name: myotilin
Synonyms: 5530402I04Rik, Ttid
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58916
Homologene: 4942
Bscl2
Name: BSCL2 lipid droplet biogenesis associated, seipin
Synonyms: seipin, Gng3lg
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14705
Homologene: 32032
Map1lc3b
Name: microtubule-associated protein 1 light chain 3 beta
Synonyms: 1010001C15Rik, Map1lc3, LC3b, Atg8
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67443
Homologene: 69359
Gzmd
Name: granzyme D
Synonyms: CCP5, Ctla-5, Ctla5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14941
Homologene: 133275
Stk25
Name: serine/threonine kinase 25 (yeast)
Synonyms: Ste20-like, Ysk1, 1500019J11Rik, SOK-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59041
Homologene: 48428
Polb
Name: polymerase (DNA directed), beta
Synonyms: Pol beta, A430088C08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18970
HGNC: HGNC:9174
Homologene: 2013
Skint8
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639774
Homologene: 106613
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Cyp3a25
Name: cytochrome P450, family 3, subfamily a, polypeptide 25
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56388
Homologene: 135775
Tspan10
Name: tetraspanin 10
Synonyms: Ocsp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208634
Homologene: 49972
Mapk13
Name: mitogen-activated protein kinase 13
Synonyms: p38 delta MAP kinase, SAPK4, Serk4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26415
HGNC: HGNC:6875
Homologene: 48133
Tmem39b
Name: transmembrane protein 39b
Synonyms: 6330509E05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230770
Homologene: 23069
Vmn1r6
Name: vomeronasal 1 receptor 6
Synonyms: V1rc20
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171193
Homologene: 128340
Or8g36
Name: olfactory receptor family 8 subfamily G member 36
Synonyms: GA_x6K02T2PVTD-33208209-33207274, MOR171-12, Olfr957
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258740
VEGA: 9
Dbndd2
Name: dysbindin domain containing 2
Synonyms: 2900022J10Rik, 1110017A21Rik, D2Bwg0891e, NKIP, dysbindin (dystrobrevin binding protein 1) domain containing 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52840
Homologene: 12276
Sh3tc2
Name: SH3 domain and tetratricopeptide repeats 2
Synonyms: D430044G18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225608
VEGA: 18
Homologene: 11596
Or5w1
Name: olfactory receptor family 5 subfamily W member 1
Synonyms: GA_x6K02T2Q125-49162076-49161138, MOR176-1, Olfr1134
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259032
Homologene: 37013
Hsd3b6
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 6
Synonyms: 3beta-HSD VI
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15497
Homologene: 133013
Ccdc182
Name: coiled-coil domain containing 182
Synonyms: 1700106J16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74297
Homologene: 87544
Tssk1
Name: testis-specific serine kinase 1
Synonyms: Tsk1, TSK-1, Tssk, Stk22a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22114
Homologene: 56448
Sgo2b
Name: shugoshin 2B
Synonyms: Gm4975, Sgol2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244495
Homologene: 51867
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Or8g29
Name: olfactory receptor family 8 subfamily G member 29
Synonyms: GA_x6K02T2PVTD-32987171-32986232, MOR171-43, Or8g29-ps1, Olfr947-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257924
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 90,779,298 bp (GRCm38)
  • T to C, chromosome 1 at 93,625,084 bp (GRCm38)
  • G to A, chromosome 1 at 156,316,846 bp (GRCm38)
  • A to G, chromosome 1 at 181,135,028 bp (GRCm38)
  • T to C, chromosome 2 at 36,527,547 bp (GRCm38)
  • A to T, chromosome 2 at 87,656,316 bp (GRCm38)
  • T to G, chromosome 2 at 102,831,402 bp (GRCm38)
  • C to T, chromosome 2 at 125,563,984 bp (GRCm38)
  • T to C, chromosome 2 at 164,486,157 bp (GRCm38)
  • T to C, chromosome 2 at 166,891,770 bp (GRCm38)
  • T to C, chromosome 3 at 26,732,881 bp (GRCm38)
  • T to A, chromosome 3 at 37,225,528 bp (GRCm38)
  • T to C, chromosome 3 at 98,806,363 bp (GRCm38)
  • T to C, chromosome 4 at 58,869,427 bp (GRCm38)
  • C to A, chromosome 4 at 111,936,962 bp (GRCm38)
  • C to A, chromosome 4 at 128,419,530 bp (GRCm38)
  • A to T, chromosome 4 at 129,678,675 bp (GRCm38)
  • C to A, chromosome 5 at 24,589,237 bp (GRCm38)
  • C to A, chromosome 5 at 100,385,224 bp (GRCm38)
  • A to G, chromosome 5 at 101,848,493 bp (GRCm38)
  • T to A, chromosome 5 at 113,280,335 bp (GRCm38)
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp (GRCm38)
  • G to C, chromosome 5 at 117,879,337 bp (GRCm38)
  • T to C, chromosome 5 at 125,109,924 bp (GRCm38)
  • C to A, chromosome 5 at 142,143,795 bp (GRCm38)
  • T to C, chromosome 5 at 145,991,546 bp (GRCm38)
  • A to G, chromosome 6 at 57,002,775 bp (GRCm38)
  • C to T, chromosome 6 at 106,489,761 bp (GRCm38)
  • T to C, chromosome 6 at 118,613,327 bp (GRCm38)
  • T to C, chromosome 7 at 16,157,231 bp (GRCm38)
  • T to A, chromosome 7 at 56,113,142 bp (GRCm38)
  • A to G, chromosome 7 at 83,632,045 bp (GRCm38)
  • T to C, chromosome 7 at 99,458,782 bp (GRCm38)
  • C to A, chromosome 7 at 102,138,830 bp (GRCm38)
  • C to T, chromosome 7 at 109,048,005 bp (GRCm38)
  • A to T, chromosome 8 at 22,653,068 bp (GRCm38)
  • T to A, chromosome 8 at 22,681,719 bp (GRCm38)
  • A to C, chromosome 8 at 63,938,373 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to A, chromosome 8 at 117,019,420 bp (GRCm38)
  • T to C, chromosome 8 at 121,596,094 bp (GRCm38)
  • T to A, chromosome 9 at 39,289,306 bp (GRCm38)
  • A to T, chromosome 9 at 39,510,853 bp (GRCm38)
  • A to G, chromosome 9 at 75,189,997 bp (GRCm38)
  • C to T, chromosome 9 at 108,294,509 bp (GRCm38)
  • T to C, chromosome 9 at 123,678,876 bp (GRCm38)
  • T to C, chromosome 10 at 76,799,543 bp (GRCm38)
  • T to C, chromosome 10 at 106,913,568 bp (GRCm38)
  • T to A, chromosome 10 at 111,286,151 bp (GRCm38)
  • C to T, chromosome 11 at 67,085,029 bp (GRCm38)
  • T to C, chromosome 11 at 88,294,352 bp (GRCm38)
  • T to A, chromosome 11 at 110,329,339 bp (GRCm38)
  • T to C, chromosome 11 at 120,446,225 bp (GRCm38)
  • T to C, chromosome 11 at 120,813,089 bp (GRCm38)
  • C to T, chromosome 12 at 104,265,469 bp (GRCm38)
  • T to A, chromosome 12 at 105,833,144 bp (GRCm38)
  • T to A, chromosome 13 at 67,257,154 bp (GRCm38)
  • T to C, chromosome 13 at 115,049,298 bp (GRCm38)
  • T to G, chromosome 14 at 56,131,333 bp (GRCm38)
  • A to G, chromosome 15 at 101,016,575 bp (GRCm38)
  • A to T, chromosome 16 at 17,894,860 bp (GRCm38)
  • A to G, chromosome 17 at 28,769,516 bp (GRCm38)
  • C to A, chromosome 17 at 34,614,517 bp (GRCm38)
  • T to C, chromosome 18 at 44,346,198 bp (GRCm38)
  • A to C, chromosome 18 at 61,974,527 bp (GRCm38)
  • A to T, chromosome 19 at 8,843,014 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9249 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069074-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.