Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9241Btlr/Mmmh
Stock Number:
069068-MU
Citation ID:
RRID:MMRRC_069068-MU
Other Names:
R9241 (G1)
Major Collection:

Strain Information

Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Mapt
Name: microtubule-associated protein tau
Synonyms: Mtapt, Tau
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17762
HGNC: HGNC:6893
Homologene: 74962
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Ano6
Name: anoctamin 6
Synonyms: 2900059G15Rik, F730003B03Rik, Tmem16f
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105722
VEGA: 15
Homologene: 27888
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Plekha5
Name: pleckstrin homology domain containing, family A member 5
Synonyms: PEPP2, 2810431N21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109135
Homologene: 10377
Tesmin
Name: testis expressed metallothionein like
Synonyms: tesmin, Mtl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17771
HGNC: HGNC:7446
Homologene: 31275
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Oprl1
Name: opioid receptor-like 1
Synonyms: MOR-C, ORL1, XOR1, LC132, nociceptin/ orphaninFQ receptor, morc, N/OFQ receptor, NOP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18389
HGNC: HGNC:8155
Homologene: 22609
Lepr
Name: leptin receptor
Synonyms: Obr, leptin receptor gene-related protein, OB-RGRP, LEPROT, obl, obese-like, Modb1, Leprb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Cdcp1
Name: CUB domain containing protein 1
Synonyms: 9030022E12Rik, E030027H19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109332
Homologene: 11276
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Nup50
Name: nucleoporin 50
Synonyms: Npap60, 1700030K07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18141
VEGA: 15
HGNC: HGNC:8065
Homologene: 5190
Septin9
Name: septin 9
Synonyms: SL3-3 integration site 1, Sint1, Msf, MSF1, PNUTL4, Sept9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53860
HGNC: HGNC:7323
Homologene: 90949
Tpcn1
Name: two pore channel 1
Synonyms: 5730403B01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 252972
Homologene: 9905
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Trpv1
Name: transient receptor potential cation channel, subfamily V, member 1
Synonyms: capsaicin receptor, VR-1, OTRPC1, Vr1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193034
Homologene: 12920
Jag1
Name: jagged 1
Synonyms: Serrate-1, Headturner, Htu, ABE2, Ozz, Gsfabe2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16449
HGNC: HGNC:6188
Homologene: 180
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Smc1b
Name: structural maintenance of chromosomes 1B
Synonyms: SMC1beta, Smc1l2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 140557
VEGA: 15
Homologene: 13786
Aox4
Name: aldehyde oxidase 4
Synonyms: AOH2, 2310003G12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71872
Homologene: 70273
Kash5
Name: KASH domain containing 5
Synonyms: LOC384619, Ccdc155
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384619
Homologene: 16973
Zfp563
Name: zinc finger protein 563
Synonyms: zinc finger protein, Zfp413
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240068
Homologene: 77346
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Gm9922
Name: predicted gene 9922
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102633345
VEGA: 14
Dyrk1b
Name: dual-specificity tyrosine phosphorylation regulated kinase 1b
Synonyms: Mirk
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13549
HGNC: HGNC:3092
Homologene: 31253
Tnk2
Name: tyrosine kinase, non-receptor, 2
Synonyms: P21cdc42Hs kinase, Ack, activated p21cdc42Hs kinase, ACK1, Pyk1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 51789
Homologene: 4224
Prkn
Name: parkin RBR E3 ubiquitin protein ligase
Synonyms: PRKN, Parkin, Park2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50873
HGNC: HGNC:8607
Homologene: 3355
Scgb1a1
Name: secretoglobin, family 1A, member 1
Synonyms: CCSP, CC10, Blastokinin, UG, Utg, CC16, PCB-BP, club cell secretory protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22287
Homologene: 2518
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 280635
Homologene: 18817
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Hcfc2
Name: host cell factor C2
Synonyms: 1700129L13Rik, fkls
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67933
Homologene: 8337
Or2n1e
Name: olfactory receptor family 2 subfamily N member 1E
Synonyms: Olfr89, MOR256-40P, GA_x6K02T2PSCP-2718585-2719523, Olfr138
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 170648
Homologene: 119758
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Mfap3
Name: microfibrillar-associated protein 3
Synonyms: 2700079M14Rik, 2610509F16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216760
HGNC: HGNC:7034
Homologene: 4333
Mapk13
Name: mitogen-activated protein kinase 13
Synonyms: p38 delta MAP kinase, SAPK4, Serk4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26415
HGNC: HGNC:6875
Homologene: 48133
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 321008
Homologene: 52386
Aldh2
Name: aldehyde dehydrogenase 2, mitochondrial
Synonyms: Ahd5, Ahd-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11669
HGNC: HGNC:404
Homologene: 55480
Saxo2
Name: stabilizer of axonemal microtubules 2
Synonyms: 1700129I04Rik, Fam154b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330577
Homologene: 25135
Cryge
Name: crystallin, gamma E
Synonyms: Cryg-6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12968
HGNC: HGNC:2411
Homologene: 128417
1700030J22Rik
Name: RIKEN cDNA 1700030J22 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69528
Homologene: 51842
Pole3
Name: polymerase (DNA directed), epsilon 3 (p17 subunit)
Synonyms: YBL1, 1810034K18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 59001
Homologene: 9694
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353235
HGNC: HGNC:8675
Homologene: 129614
Tmem200c
Name: transmembrane protein 200C
Synonyms: Gm6338
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 622645
VEGA: 17
Homologene: 78765
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
AC157566.4
Name:
Type: Gene
Species: Mouse
Chromosome: 15
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 58,252,186 bp (GRCm38)
  • T to G, chromosome 1 at 65,048,859 bp (GRCm38)
  • T to A, chromosome 2 at 25,245,907 bp (GRCm38)
  • T to A, chromosome 2 at 59,913,649 bp (GRCm38)
  • C to T, chromosome 2 at 130,691,744 bp (GRCm38)
  • T to C, chromosome 2 at 137,084,587 bp (GRCm38)
  • T to C, chromosome 2 at 160,908,257 bp (GRCm38)
  • C to T, chromosome 2 at 181,718,612 bp (GRCm38)
  • C to T, chromosome 3 at 5,243,637 bp (GRCm38)
  • G to A, chromosome 4 at 53,734,854 bp (GRCm38)
  • A to G, chromosome 4 at 62,524,608 bp (GRCm38)
  • G to T, chromosome 4 at 101,814,591 bp (GRCm38)
  • T to C, chromosome 4 at 123,378,159 bp (GRCm38)
  • C to T, chromosome 5 at 21,969,069 bp (GRCm38)
  • T to A, chromosome 5 at 113,819,586 bp (GRCm38)
  • C to T, chromosome 5 at 120,553,493 bp (GRCm38)
  • T to C, chromosome 5 at 121,572,157 bp (GRCm38)
  • T to C, chromosome 6 at 140,579,478 bp (GRCm38)
  • A to T, chromosome 7 at 13,269,434 bp (GRCm38)
  • A to G, chromosome 7 at 28,186,633 bp (GRCm38)
  • A to G, chromosome 7 at 45,183,889 bp (GRCm38)
  • T to C, chromosome 7 at 82,635,042 bp (GRCm38)
  • A to G, chromosome 7 at 116,417,880 bp (GRCm38)
  • A to T, chromosome 7 at 135,695,924 bp (GRCm38)
  • G to T, chromosome 8 at 67,963,315 bp (GRCm38)
  • A to G, chromosome 8 at 116,971,198 bp (GRCm38)
  • T to G, chromosome 9 at 21,639,308 bp (GRCm38)
  • A to T, chromosome 9 at 41,974,124 bp (GRCm38)
  • C to A, chromosome 9 at 123,185,236 bp (GRCm38)
  • T to C, chromosome 10 at 82,732,651 bp (GRCm38)
  • A to T, chromosome 11 at 30,865,576 bp (GRCm38)
  • T to C, chromosome 11 at 55,256,740 bp (GRCm38)
  • A to G, chromosome 11 at 57,529,846 bp (GRCm38)
  • A to G, chromosome 11 at 73,260,356 bp (GRCm38)
  • A to T, chromosome 11 at 104,298,971 bp (GRCm38)
  • C to A, chromosome 11 at 117,218,898 bp (GRCm38)
  • G to T, chromosome 13 at 19,094,802 bp (GRCm38)
  • T to C, chromosome 13 at 117,656,713 bp (GRCm38)
  • A to T, chromosome 14 at 101,729,784 bp (GRCm38)
  • G to T, chromosome 14 at 123,572,017 bp (GRCm38)
  • A to G, chromosome 15 at 84,938,410 bp (GRCm38)
  • T to C, chromosome 15 at 85,092,008 bp (GRCm38)
  • T to C, chromosome 15 at 95,791,006 bp (GRCm38)
  • A to C, chromosome 16 at 32,670,098 bp (GRCm38)
  • T to A, chromosome 16 at 91,657,234 bp (GRCm38)
  • A to T, chromosome 17 at 11,237,495 bp (GRCm38)
  • A to T, chromosome 17 at 28,771,213 bp (GRCm38)
  • A to T, chromosome 17 at 33,102,546 bp (GRCm38)
  • A to G, chromosome 17 at 38,274,890 bp (GRCm38)
  • G to T, chromosome 17 at 68,837,166 bp (GRCm38)
  • C to T, chromosome 18 at 36,993,955 bp (GRCm38)
  • T to C, chromosome 19 at 3,389,010 bp (GRCm38)
  • T to C, chromosome 19 at 9,087,929 bp (GRCm38)
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9241 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069068-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.