Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9111Btlr/Mmmh
Stock Number:
068971-MU
Citation ID:
RRID:MMRRC_068971-MU
Other Names:
R9111 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Cdr2
Name: cerebellar degeneration-related 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12585
HGNC: HGNC:1799
Homologene: 7262
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Prkd2
Name: protein kinase D2
Synonyms: PKD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101540
Homologene: 9516
Prmt1
Name: protein arginine N-methyltransferase 1
Synonyms: 6720434D09Rik, Hrmt1l2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15469
HGNC: HGNC:5187
Homologene: 21477
Cdc42bpb
Name: CDC42 binding protein kinase beta
Synonyms: DMPK-like
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217866
VEGA: 12
HGNC: HGNC:1738
Homologene: 55945
Sfpq
Name: splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)
Synonyms: D4Ertd314e, 9030402K04Rik, 2810416M14Rik, 5730453G22Rik, 1110004P21Rik, REP1, PSF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71514
Homologene: 3714
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Sf3a2
Name: splicing factor 3a, subunit 2
Synonyms: SFA66, PRP11, Sap62, 66kDa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20222
Homologene: 133823
Secisbp2l
Name: SECIS binding protein 2-like
Synonyms: 3110001I20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70354
Homologene: 18923
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Dlat
Name: dihydrolipoamide S-acetyltransferase
Synonyms: PDC-E2, 6332404G05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235339
HGNC: HGNC:2896
Homologene: 6814
Kalrn
Name: kalirin, RhoGEF kinase
Synonyms: LOC224126, Hapip, 2210407G14Rik, E530005C20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 545156
HGNC: HGNC:4814
Homologene: 57160
Eif4e
Name: eukaryotic translation initiation factor 4E
Synonyms: eIF-4E, If4e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13684
HGNC: HGNC:3287
Homologene: 123817
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
P2rx6
Name: purinergic receptor P2X, ligand-gated ion channel, 6
Synonyms: P2xm, P2rxl1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18440
HGNC: HGNC:8538
Homologene: 3975
Aldh3b1
Name: aldehyde dehydrogenase 3 family, member B1
Synonyms: ALDH7, ALDH4, 1700001N19Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67689
VEGA: 19
HGNC: HGNC:410
Homologene: 73890
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12807
Homologene: 13019
Mmp9
Name: matrix metallopeptidase 9
Synonyms: gelatinase B, Gel B, MMP-9, B/MMP9, Clg4b, Gelatinase B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17395
HGNC: HGNC:7176
Homologene: 3659
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270066
Homologene: 49075
Zhx2
Name: zinc fingers and homeoboxes 2
Synonyms: Raf, Afr-1, Afr1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 387609
Homologene: 8968
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: 6330444M21Rik, D16Ertd642e, Wdr52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212517
Homologene: 75085
Fbxw16
Name: F-box and WD-40 domain protein 16
Synonyms: 7420402K12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320083
Homologene: 110776
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Slc9a3
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms: NHE3, 9030624O13Rik, NHE-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105243
VEGA: 13
Homologene: 55804
Cmklr1
Name: chemerin chemokine-like receptor 1
Synonyms: Gpcr27, ChemR23
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14747
HGNC: HGNC:2121
Homologene: 129967
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Kcng1
Name: potassium voltage-gated channel, subfamily G, member 1
Synonyms: OTTMUSG00000016048
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241794
HGNC: HGNC:6248
Homologene: 20515
Ugt3a2
Name: UDP glycosyltransferases 3 family, polypeptide A2
Synonyms: Ugt3a, Ugt3a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105887
Homologene: 122787
Ccdc28a
Name: coiled-coil domain containing 28A
Synonyms: 1700009P13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215814
Homologene: 56705
Slc5a4b
Name: solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms: 2010104G07Rik, pSGLT2, SAAT1, SGLT3b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64454
Homologene: 56968
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Or4c107
Name: olfactory receptor family 4 subfamily C member 107
Synonyms: GA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17, Olfr1212
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258241
Homologene: 66154
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Myrf
Name: myelin regulatory factor
Synonyms: LOC225908, LOC386531, Gm98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Abcb10
Name: ATP-binding cassette, sub-family B member 10
Synonyms: ABC-me
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56199
HGNC: HGNC:41
Homologene: 6474
Adamts17
Name: ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms: AU023434
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233332
Homologene: 16373
Cdk14
Name: cyclin dependent kinase 14
Synonyms: Pftk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18647
HGNC: HGNC:8883
Homologene: 7888
Rnf133
Name: ring finger protein 133
Synonyms: Greul2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 386611
Homologene: 44549
Dcdc2c
Name: doublecortin domain containing 2C
Synonyms: 1110015M06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68511
Homologene: 131934
Fscn3
Name: fascin actin-bundling protein 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56223
HGNC: HGNC:3961
Homologene: 10475
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Rps18-ps5
Name: ribosomal protein S18, pseudogene 5
Synonyms: Gm11361
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100042388
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 181,817,503 bp
  • G to A, chromosome 2 at 88,958,711 bp
  • A to G, chromosome 2 at 125,760,286 bp
  • T to A, chromosome 2 at 164,950,806 bp
  • C to A, chromosome 2 at 168,262,615 bp
  • A to T, chromosome 3 at 19,973,785 bp
  • T to C, chromosome 3 at 20,030,411 bp
  • A to G, chromosome 3 at 138,546,361 bp
  • A to G, chromosome 4 at 102,597,460 bp
  • T to C, chromosome 4 at 123,513,026 bp
  • CCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGC, chromosome 4 at 127,021,608 bp
  • G to A, chromosome 5 at 5,265,985 bp
  • A to T, chromosome 5 at 53,121,871 bp
  • G to C, chromosome 5 at 113,613,982 bp
  • G to A, chromosome 6 at 23,648,929 bp
  • A to G, chromosome 6 at 28,430,311 bp
  • A to G, chromosome 7 at 16,850,206 bp
  • A to C, chromosome 7 at 44,981,745 bp
  • A to G, chromosome 7 at 66,839,900 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • A to G, chromosome 7 at 116,394,296 bp
  • G to A, chromosome 7 at 120,960,122 bp
  • A to G, chromosome 7 at 134,999,288 bp
  • G to A, chromosome 8 at 72,492,186 bp
  • T to C, chromosome 8 at 123,969,907 bp
  • G to A, chromosome 9 at 50,659,606 bp
  • T to C, chromosome 9 at 109,436,611 bp
  • G to A, chromosome 10 at 18,225,002 bp
  • A to T, chromosome 10 at 76,089,993 bp
  • T to C, chromosome 10 at 79,545,451 bp
  • ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT to ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT, chromosome 10 at 80,804,437 bp
  • T to A, chromosome 11 at 62,389,759 bp
  • T to A, chromosome 12 at 28,535,489 bp
  • A to T, chromosome 12 at 111,318,469 bp
  • T to A, chromosome 13 at 28,257,643 bp
  • A to G, chromosome 13 at 74,150,801 bp
  • G to A, chromosome 14 at 72,456,683 bp
  • T to C, chromosome 15 at 9,306,247 bp
  • T to C, chromosome 15 at 57,822,588 bp
  • C to T, chromosome 15 at 101,543,351 bp
  • G to T, chromosome 16 at 17,567,763 bp
  • A to G, chromosome 16 at 34,361,001 bp
  • A to T, chromosome 16 at 44,431,963 bp
  • T to C, chromosome 17 at 74,659,345 bp
  • T to C, chromosome 18 at 20,034,707 bp
  • T to C, chromosome 19 at 3,921,797 bp
  • G to A, chromosome 19 at 6,261,504 bp
  • A to G, chromosome 19 at 10,214,057 bp
  • C to T, chromosome X at 49,786,859 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9111 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068971-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.