Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9106Btlr/Mmmh
Stock Number:
068970-MU
Citation ID:
RRID:MMRRC_068970-MU
Other Names:
R9106 (G1)
Major Collection:

Strain Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Ubp1
Name: upstream binding protein 1
Synonyms: NF2d9, LBP-1b, LBP-1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22221
VEGA: 9
Homologene: 8435
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Mapkapk3
Name: mitogen-activated protein kinase-activated protein kinase 3
Synonyms: MK3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102626
HGNC: HGNC:6888
Homologene: 55836
Ssr2
Name: signal sequence receptor, beta
Synonyms: TRAPbeta
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66256
Homologene: 2369
Trim36
Name: tripartite motif-containing 36
Synonyms: D18Wsu100e, Haprin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Banp
Name: BTG3 associated nuclear protein
Synonyms: SMAR1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 53325
Homologene: 9635
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53890
Homologene: 40977
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Mafg
Name: v-maf musculoaponeurotic fibrosarcoma oncogene family, protein G (avian)
Synonyms: C630022N07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17134
HGNC: HGNC:6781
Homologene: 81816
Ppp3r1
Name: protein phosphatase 3, regulatory subunit B, alpha isoform (calcineurin B, type I)
Synonyms: PP2B beta 1, Cnb1, CaNB1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19058
HGNC: HGNC:9317
Homologene: 68099
Sgo2a
Name: shugoshin 2A
Synonyms: 5730576N04Rik, Tripin, 1110007N04Rik, D1Ertd8e, Sgol2, Sgol2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68549
Homologene: 51867
Htr1f
Name: 5-hydroxytryptamine (serotonin) receptor 1F
Synonyms: Htr1eb
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15557
VEGA: 16
HGNC: HGNC:5292
Homologene: 37361
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: CD140b, Pdgfr
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Map2
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Mrnip
Name: MRN complex interacting protein
Synonyms: 3010026O09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68067
Homologene: 75241
Mzt2
Name: mitotic spindle organizing protein 2
Synonyms: 2610001E06Rik, 2410018G20Rik, Fam128b
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72083
Homologene: 135760
Prmt9
Name: protein arginine methyltransferase 9
Synonyms: Prmt10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102182
Homologene: 16298
Patl1
Name: protein associated with topoisomerase II homolog 1 (yeast)
Synonyms: Pat1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225929
VEGA: 19
Homologene: 82269
Map4k3
Name: mitogen-activated protein kinase kinase kinase kinase 3
Synonyms: 9530052P13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225028
VEGA: 17
HGNC: HGNC:6865
Homologene: 2683
Mideas
Name: mitotic deacetylase associated SANT domain protein
Synonyms: 9430029N19Rik, C130039O16Rik, Elmsan1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238317
Homologene: 19330
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Vit
Name: vitrin
Synonyms: 1700110E08Rik, 1700052E02Rik, 2810429K11Rik, AKH, akhirin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74199
VEGA: 17
Homologene: 24942
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Clspn
Name: claspin
Synonyms: E130314M08Rik, C85083
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269582
Homologene: 11138
Rabl6
Name: RAB, member RAS oncogene family-like 6
Synonyms: Rbel1b, Rbel1, Rbel1a, B230208H17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227624
Homologene: 11674
Nlrp9c
Name: NLR family, pyrin domain containing 9C
Synonyms: Nalp9c, Nalp-zeta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330490
Homologene: 116072
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227377
Homologene: 8877
Cfap69
Name: cilia and flagella associated protein 69
Synonyms: A330021E22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207686
Homologene: 11718
Cgnl1
Name: cingulin-like 1
Synonyms: Jacop, 4933421H10Rik, 9930020M10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68178
Homologene: 41901
Slc8b1
Name: solute carrier family 8 (sodium/lithium/calcium exchanger), member B1
Synonyms: NCKX6, NCLX, Slc24a6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 170756
Homologene: 41602
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: 4930463I21Rik, Armc4, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Vmn2r59
Name: vomeronasal 2, receptor 59
Synonyms: EG628444
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628444
Homologene: 129683
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Slco1b2
Name: solute carrier organic anion transporter family, member 1b2
Synonyms: mlst-1, Slc21a6, Slc21a10, Oatp1b2, 7330442B20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28253
Homologene: 75119
Ppp4r4
Name: protein phosphatase 4, regulatory subunit 4
Synonyms: 8430415E04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74521
Homologene: 12571
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Lrit1
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 1
Synonyms: Lrrc21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239037
Homologene: 9215
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Or51q1
Name: olfactory receptor family 51 subfamily Q member 1
Synonyms: GA_x6K02T2PBJ9-6713641-6714588, MOR5-2, Olfr635
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259122
Homologene: 133592
Spata31e5
Name: spermatogenesis associated 31 subfamily E member 5
Synonyms: LOC210962, Gm597
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210962
Gm1527
Name: predicted gene 1527
Synonyms: LOC385263
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 385263
Homologene: 133976
Galnt7
Name: polypeptide N-acetylgalactosaminyltransferase 7
Synonyms: ppGaNTase-T7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108150
HGNC: HGNC:4129
Homologene: 9685
Ly6f
Name: lymphocyte antigen 6 family member F
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17071
Homologene: 113718
Myrip
Name: myosin VIIA and Rab interacting protein
Synonyms: Slac2-c, A230081N12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245049
Homologene: 9150
Rnf19b
Name: ring finger protein 19B
Synonyms: 4930534K13Rik, 4930555L03Rik, Ibrdc3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75234
Homologene: 34999
Or6k2
Name: olfactory receptor family 6 subfamily K member 2
Synonyms: GA_x6K02T2P20D-20995211-20994246, MOR105-10, Olfr420
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258302
Homologene: 17185
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233230
Homologene: 115575
Ctdsp1
Name: CTD small phosphatase 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227292
Homologene: 100834
Mapk10
Name: mitogen-activated protein kinase 10
Synonyms: p493F12, JNK3, Serk2, C230008H04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26414
HGNC: HGNC:6872
Homologene: 56439
Mos
Name: Moloney sarcoma oncogene
Synonyms: c-mos
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17451
HGNC: HGNC:7199
Homologene: 3919
Or52a20
Name: olfactory receptor family 52 subfamily A member 20
Synonyms: GA_x6K02T2L9TJ-1933-2295, GA_x6K02T2PBJ9-6440320-6440766, MOR22-4, Olfr627, Olfr243
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436002
Homologene: 8420
Slc27a5
Name: solute carrier family 27 (fatty acid transporter), member 5
Synonyms: FATP5, FACVL3, VLCSH2, VLCS-H2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26459
Homologene: 7596
Tagap
Name: T cell activation Rho GTPase activating protein
Synonyms: tcs-1, Tcd-1, tcs1, TRD, Tcd1, Tcd1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72536
Homologene: 44943
Hps4
Name: HPS4, biogenesis of lysosomal organelles complex 3 subunit 2
Synonyms: C130020P05Rik, BLOC-3, 2010205O06Rik, Hermansky-Pudlak syndrome 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192232
Homologene: 11123
Or4c11b
Name: olfactory receptor family 4 subfamily C member 11B
Synonyms: GA_x6K02T2Q125-50268830-50269753, MOR230-2, Olfr1201
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258897
Homologene: 81567
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,248,885 bp
  • T to C, chromosome 1 at 28,776,894 bp
  • C to A, chromosome 1 at 57,998,124 bp
  • T to A, chromosome 1 at 66,415,363 bp
  • T to C, chromosome 1 at 74,394,725 bp
  • T to C, chromosome 1 at 93,561,188 bp
  • A to G, chromosome 1 at 174,158,803 bp
  • A to G, chromosome 1 at 179,604,597 bp
  • C to A, chromosome 1 at 179,787,036 bp
  • A to G, chromosome 2 at 25,596,434 bp
  • A to G, chromosome 2 at 88,794,672 bp
  • C to A, chromosome 3 at 28,902,291 bp
  • T to A, chromosome 3 at 88,587,962 bp
  • T to G, chromosome 4 at 3,871,457 bp
  • G to A, chromosome 4 at 126,577,450 bp
  • A to G, chromosome 4 at 129,084,147 bp
  • T to C, chromosome 5 at 5,640,190 bp
  • C to T, chromosome 5 at 36,616,338 bp
  • A to T, chromosome 5 at 103,038,576 bp
  • G to A, chromosome 5 at 112,378,039 bp
  • T to C, chromosome 5 at 113,754,349 bp
  • T to A, chromosome 5 at 120,530,351 bp
  • C to A, chromosome 5 at 121,329,556 bp
  • T to A, chromosome 5 at 123,615,160 bp
  • T to C, chromosome 6 at 73,144,769 bp
  • A to G, chromosome 6 at 141,672,248 bp
  • T to C, chromosome 6 at 149,328,870 bp
  • A to G, chromosome 7 at 12,991,170 bp
  • G to T, chromosome 7 at 26,382,412 bp
  • A to T, chromosome 7 at 42,046,460 bp
  • A to G, chromosome 7 at 48,198,931 bp
  • T to C, chromosome 7 at 88,074,539 bp
  • G to A, chromosome 7 at 103,717,530 bp
  • A to T, chromosome 7 at 103,979,374 bp
  • T to C, chromosome 7 at 112,082,506 bp
  • T to G, chromosome 8 at 57,532,695 bp
  • A to G, chromosome 8 at 77,549,729 bp
  • A to T, chromosome 8 at 121,978,633 bp
  • C to T, chromosome 9 at 42,367,183 bp
  • A to G, chromosome 9 at 49,517,556 bp
  • C to A, chromosome 9 at 71,721,591 bp
  • T to A, chromosome 9 at 107,258,868 bp
  • A to G, chromosome 9 at 113,970,251 bp
  • T to C, chromosome 9 at 120,432,478 bp
  • A to G, chromosome 11 at 17,194,789 bp
  • A to G, chromosome 11 at 50,174,941 bp
  • T to C, chromosome 11 at 83,212,632 bp
  • GGTTCTTCAGTGT to GGT, chromosome 11 at 120,629,589 bp
  • T to C, chromosome 12 at 84,152,553 bp
  • C to T, chromosome 12 at 103,604,056 bp
  • T to C, chromosome 13 at 23,478,295 bp
  • G to A, chromosome 14 at 37,054,934 bp
  • T to C, chromosome 15 at 73,259,608 bp
  • G to T, chromosome 15 at 75,269,857 bp
  • C to A, chromosome 15 at 76,305,676 bp
  • AGCCGCTGCCGCTGCCGCTGCCGC to AGCCGCTGCCGCTGCCGC, chromosome 15 at 99,946,226 bp
  • A to G, chromosome 16 at 15,848,704 bp
  • T to C, chromosome 16 at 45,860,394 bp
  • A to T, chromosome 16 at 64,926,274 bp
  • A to T, chromosome 17 at 7,931,448 bp
  • G to A, chromosome 17 at 78,626,849 bp
  • C to A, chromosome 17 at 80,727,828 bp
  • A to T, chromosome 18 at 7,294,527 bp
  • A to T, chromosome 18 at 46,167,597 bp
  • A to T, chromosome 18 at 61,046,028 bp
  • A to G, chromosome 19 at 11,931,609 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9106 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068970-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.