Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9152Btlr/Mmmh
Stock Number:
068939-MU
Citation ID:
RRID:MMRRC_068939-MU
Other Names:
R9152 (G1)
Major Collection:

Strain Information

Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Macroh2a1
Name: macroH2A.1 histone
Synonyms: mH2a1, MACROH2A1.2, H2AF12M, H2afy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26914
HGNC: HGNC:4740
Homologene: 3598
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, recombination induced mutation 2, Hps2, beta3A, AP-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Septin11
Name: septin 11
Synonyms: 6230410I01Rik, D5Ertd606e, Sept11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52398
Homologene: 56800
Usp22
Name: ubiquitin specific peptidase 22
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216825
Homologene: 52664
Rbbp6
Name: retinoblastoma binding protein 6, ubiquitin ligase
Synonyms: 4933422O15Rik, C030034J04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19647
HGNC: HGNC:9889
Homologene: 136812
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Helq
Name: helicase, POLQ-like
Synonyms: D430018E21Rik, Hel308
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 191578
Homologene: 14667
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Pex19
Name: peroxisomal biogenesis factor 19
Synonyms: Pxf, peroxisome biogenesis factor 19
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19298
HGNC: HGNC:9713
Homologene: 134253
Cul4a
Name: cullin 4A
Synonyms: 2810470J21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 99375
HGNC: HGNC:2554
Homologene: 81724
Ranbp10
Name: RAN binding protein 10
Synonyms: 4432417N03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74334
Homologene: 49639
Mlkl
Name: mixed lineage kinase domain-like
Synonyms: 9130019I15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74568
Homologene: 77416
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: ADAM-TS6, A930019D11Rik, b2b2228Clo, b2b2187.1Clo, b2b2182Clo, b2b2029Clo, b2b1879.1Clo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: LOC381663, A330009G12Rik, Sec63d1, Mer3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330149
Homologene: 87103
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, 4831403C07Rik, E230025N21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: NG2, AN2, 4732461B14Rik, Cspg4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Arsa
Name: arylsulfatase A
Synonyms: As-2, ASA, As2, AS-A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11883
HGNC: HGNC:713
Homologene: 20138
Prkch
Name: protein kinase C, eta
Synonyms: Pkch
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18755
HGNC: HGNC:9403
Homologene: 84384
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Lrit2
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Synonyms: A930010E21Rik, Lrrc22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239038
VEGA: 14
Homologene: 18292
Or1j11
Name: olfactory receptor family 1 subfamily E member 1
Synonyms: GA_x6K02T2NLDC-33116096-33117025, MOR136-3, Olfr339
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258951
Homologene: 133615
Dsg1c
Name: desmoglein 1 gamma
Synonyms: Dsg6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211924
HGNC: HGNC:3048
Or7g32
Name: olfactory receptor family 7 subfamily G member 32
Synonyms: GA_x6K02T2PVTD-13234278-13235216, MOR155-1, Olfr851
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258907
HGNC: HGNC:8466
Homologene: 74178
Or2k2
Name: olfactory receptor family 2 subfamily K member 2
Synonyms: GA_x6K02T2N78B-1272842-1273783, MOR262-1, Olfr267
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258922
HGNC: HGNC:8264
Homologene: 17436
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Psg22
Name: pregnancy-specific beta-1-glycoprotein 22
Synonyms: cea9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243862
HGNC: HGNC:1816
Homologene: 110989
Tex24
Name: testis expressed gene 24
Synonyms: TESF-1, 1700108N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 541463
Mgat2
Name: mannoside acetylglucosaminyltransferase 2
Synonyms: GNT-II, CDGS2, GNT2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217664
HGNC: HGNC:7045
Homologene: 1806
Zdhhc22
Name: zinc finger, DHHC-type containing 22
Synonyms: LOC238331
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238331
VEGA: 12
Homologene: 45486
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: 9230107O05Rik, D1Mgi1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Trim56
Name: tripartite motif-containing 56
Synonyms: LOC384309, RNF109, A130009K11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384309
Homologene: 12812
Clrn2
Name: clarin 2
Synonyms: EG624224, mpc169H
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 624224
Homologene: 84057
Rrh
Name: retinal pigment epithelium derived rhodopsin homolog
Synonyms: Peropsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20132
Homologene: 55977
Qpctl
Name: glutaminyl-peptide cyclotransferase-like
Synonyms: 1810019P04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67369
Homologene: 9765
Eif1ad11
Name: eukaryotic translation initiation factor 1A domain containing 11
Synonyms: Gm2056
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039129
VEGA: 12
Trav18
Name: T cell receptor alpha variable 18
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 547427
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 21,469,468 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • T to A, chromosome 2 at 36,421,427 bp
  • T to C, chromosome 2 at 120,698,587 bp
  • T to C, chromosome 2 at 121,198,575 bp
  • A to T, chromosome 3 at 129,813,254 bp
  • T to C, chromosome 4 at 58,785,114 bp
  • G to A, chromosome 4 at 137,522,565 bp
  • T to C, chromosome 5 at 45,463,912 bp
  • T to C, chromosome 5 at 93,139,470 bp
  • G to T, chromosome 5 at 100,770,459 bp
  • T to A, chromosome 5 at 106,841,745 bp
  • A to G, chromosome 5 at 113,819,406 bp
  • T to C, chromosome 5 at 137,114,533 bp
  • A to T, chromosome 7 at 18,726,721 bp
  • A to G, chromosome 7 at 19,149,100 bp
  • T to A, chromosome 7 at 75,611,285 bp
  • G to A, chromosome 7 at 116,417,769 bp
  • A to G, chromosome 7 at 123,001,474 bp
  • A to T, chromosome 7 at 140,297,343 bp
  • T to C, chromosome 8 at 13,105,799 bp
  • C to T, chromosome 8 at 19,026,542 bp
  • A to C, chromosome 8 at 27,345,351 bp
  • A to T, chromosome 8 at 105,772,508 bp
  • A to G, chromosome 8 at 111,319,771 bp
  • A to T, chromosome 9 at 19,497,152 bp
  • A to G, chromosome 9 at 56,888,179 bp
  • A to G, chromosome 11 at 61,158,375 bp
  • T to C, chromosome 11 at 66,130,631 bp
  • G to A, chromosome 12 at 69,185,723 bp
  • T to C, chromosome 12 at 73,691,644 bp
  • T to C, chromosome 12 at 81,975,815 bp
  • G to A, chromosome 12 at 84,791,090 bp
  • G to A, chromosome 12 at 86,988,418 bp
  • T to C, chromosome 12 at 88,027,176 bp
  • CTTACCTCCAGCT to C, chromosome 13 at 56,084,191 bp
  • T to C, chromosome 13 at 94,472,931 bp
  • T to A, chromosome 13 at 94,493,731 bp
  • C to A, chromosome 13 at 104,476,767 bp
  • C to T, chromosome 14 at 37,072,230 bp
  • A to C, chromosome 14 at 50,866,705 bp
  • A to G, chromosome 14 at 53,831,554 bp
  • T to C, chromosome 14 at 79,570,912 bp
  • G to A, chromosome 15 at 89,475,792 bp
  • T to A, chromosome 18 at 20,283,272 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9152 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068939-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.