Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9122Btlr/Mmmh
Stock Number:
068924-MU
Citation ID:
RRID:MMRRC_068924-MU
Other Names:
R9122 (G1)
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Gpr37l1
Name: G protein-coupled receptor 37-like 1
Synonyms: CAG-18, D0Kist8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171469
Homologene: 3500
2310061I04Rik
Name: RIKEN cDNA 2310061I04 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69662
Homologene: 17027
Ggta1
Name: glycoprotein galactosyltransferase alpha 1, 3
Synonyms: GALT, alpha Gal, Gal, glycoprotein alpha galactosyl transferase 1, alpha3GalT, Ggta-1, Ggta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14594
HGNC: HGNC:4253
Homologene: 7730
Pou5f1
Name: POU domain, class 5, transcription factor 1
Synonyms: Oct4, Oct3/4, Oct-3/4, Otf4, Otf3, Otf3g, Otf3-rs7, Otf-4, Otf-3, Oct-4, Oct-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18999
Homologene: 8422
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Tshr
Name: thyroid stimulating hormone receptor
Synonyms: hyt, pet, hypothroid
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22095
Homologene: 315
Trim23
Name: tripartite motif-containing 23
Synonyms: Arfd1, 6330516O20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 81003
HGNC: HGNC:660
Homologene: 1251
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Tacc1
Name: transforming, acidic coiled-coil containing protein 1
Synonyms: 4833447E04Rik, B230378H13Rik, Tacc1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 320165
Homologene: 4575
Poc1a
Name: POC1 centriolar protein A
Synonyms: 2510040D07Rik, Wdr51a, cha
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70235
Homologene: 51460
Tmem135
Name: transmembrane protein 135
Synonyms: 2810439K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72759
Homologene: 11295
Zfp980
Name: zinc finger protein 980
Synonyms: Gm13242
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041379
Homologene: 133076
Tle3
Name: transducin-like enhancer of split 3
Synonyms: Grg3b, Grg3a, ESG, 2610103N05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21887
Homologene: 21059
Nxn
Name: nucleoredoxin
Synonyms: l11Jus13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18230
Homologene: 69028
Cxxc1
Name: CXXC finger protein 1
Synonyms: 5830420C16Rik, 2410002I16Rik, PHF18, Cgbp, Cfp1, CXXC finger 1 (PHD domain)
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74322
VEGA: 18
Homologene: 32221
Ncapg
Name: non-SMC condensin I complex, subunit G
Synonyms: MFT.M05.13, Hcapg, 5730507H05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54392
Homologene: 44071
Nadk
Name: NAD kinase
Synonyms: 4432404C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192185
Homologene: 49724
H2ac25
Name: H2A clustered histone 25
Synonyms: Hist3h2a, H2aw
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319162
Homologene: 137357
Armh4
Name: armadillo-like helical domain containing 4
Synonyms: 3632451O06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67419
Homologene: 12127
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Cntnap5c
Name: contactin associated protein-like 5C
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 620292
VEGA: 17
Homologene: 128806
Cd180
Name: CD180 antigen
Synonyms: RP105, Ly78
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17079
HGNC: HGNC:6726
Homologene: 4077
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Grin2a
Name: glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms: NR2A, NMDAR2A, GluRepsilon1, GluN2A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14811
HGNC: HGNC:4585
Homologene: 645
Ddx60
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234311
Homologene: 23031
Slc24a1
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214111
VEGA: 9
Homologene: 3472
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Zfp788
Name: zinc finger protein 788
Synonyms: 2810426N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67607
Homologene: 137363
Ddx31
Name: DEAD/H box helicase 31
Synonyms: 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227674
Homologene: 6389
Ufsp2
Name: UFM1-specific peptidase 2
Synonyms: 1810047C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 192169
Homologene: 10151
Pou2f2
Name: POU domain, class 2, transcription factor 2
Synonyms: Oct2b, Oct2a, Otf-2, Oct-2, Otf2, Oct2d, Oct2c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18987
HGNC: HGNC:9213
Homologene: 55674
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
Klri1
Name: killer cell lectin-like receptor family I member 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 503550
Homologene: 86735
Rhobtb1
Name: Rho-related BTB domain containing 1
Synonyms: 1700008H16Rik, 3110048G13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69288
Homologene: 8892
Prss44
Name: serine protease 44
Synonyms: TESSP4, 1700036D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73336
Homologene: 135977
Trgv1
Name: T cell receptor gamma, variable 1
Synonyms: Gm16602, Tcrg-V1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21632
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 135,167,471 bp
  • G to A, chromosome 2 at 28,858,741 bp
  • A to T, chromosome 2 at 35,413,324 bp
  • A to G, chromosome 2 at 76,881,807 bp
  • T to A, chromosome 3 at 114,113,600 bp
  • A to G, chromosome 4 at 8,840,510 bp
  • A to C, chromosome 4 at 145,702,264 bp
  • T to A, chromosome 4 at 155,586,818 bp
  • T to C, chromosome 5 at 14,679,984 bp
  • T to A, chromosome 5 at 43,673,739 bp
  • T to C, chromosome 5 at 45,688,673 bp
  • C to A, chromosome 5 at 101,943,965 bp
  • T to A, chromosome 5 at 109,093,044 bp
  • A to G, chromosome 5 at 139,760,175 bp
  • T to A, chromosome 6 at 129,717,032 bp
  • T to C, chromosome 6 at 149,006,742 bp
  • T to A, chromosome 7 at 25,092,877 bp
  • A to T, chromosome 7 at 41,650,495 bp
  • G to C, chromosome 7 at 89,147,978 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • G to T, chromosome 8 at 25,169,239 bp
  • A to T, chromosome 8 at 45,985,404 bp
  • A to G, chromosome 8 at 61,989,864 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • C to T, chromosome 9 at 61,407,473 bp
  • C to A, chromosome 9 at 64,927,196 bp
  • T to C, chromosome 9 at 106,285,043 bp
  • T to C, chromosome 9 at 110,817,294 bp
  • T to C, chromosome 10 at 69,270,823 bp
  • T to C, chromosome 11 at 58,954,841 bp
  • A to T, chromosome 11 at 76,278,491 bp
  • A to T, chromosome 11 at 104,965,779 bp
  • A to G, chromosome 11 at 107,666,004 bp
  • C to A, chromosome 12 at 91,511,963 bp
  • G to A, chromosome 13 at 19,340,160 bp
  • C to A, chromosome 13 at 102,705,009 bp
  • A to G, chromosome 13 at 104,181,173 bp
  • C to A, chromosome 14 at 30,123,445 bp
  • G to A, chromosome 14 at 30,130,168 bp
  • A to T, chromosome 14 at 49,774,002 bp
  • A to T, chromosome 16 at 9,579,322 bp
  • C to T, chromosome 17 at 35,509,056 bp
  • C to G, chromosome 17 at 35,893,071 bp
  • A to T, chromosome 17 at 58,104,606 bp
  • T to G, chromosome 18 at 74,217,175 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9122 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068924-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.