Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9113Btlr/Mmmh
Stock Number:
068920-MU
Citation ID:
RRID:MMRRC_068920-MU
Other Names:
R9113 (G1)
Major Collection:

Strain Information

Arhgap10
Name: Rho GTPase activating protein 10
Synonyms: PSGAP-s, PSGAP-m, A930033B01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78514
Homologene: 12695
Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Chrm4
Name: cholinergic receptor, muscarinic 4
Synonyms: Chrm-4, muscarinic acetylcholine receptor 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12672
HGNC: HGNC:1953
Homologene: 20192
Atp5mf
Name: ATP synthase membrane subunit f
Synonyms: hypothetical protein, clone:2-31, 1110019H14Rik, Atp5j2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57423
HGNC: HGNC:848
Homologene: 3594
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Fbxl17
Name: F-box and leucine-rich repeat protein 17
Synonyms: Fbx13, C130023C01Rik, 6330576B01Rik, Fbxo13
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50758
Homologene: 79859
Inppl1
Name: inositol polyphosphate phosphatase-like 1
Synonyms: SHIP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16332
HGNC: HGNC:6080
Homologene: 1204
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Adgrb2
Name: adhesion G protein-coupled receptor B2
Synonyms: Bai2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230775
HGNC: HGNC:944
Homologene: 1288
Gm4924
Name: predicted gene 4924
Synonyms: mIF1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237412
Lyzl1
Name: lysozyme-like 1
Synonyms: 1700038F02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67328
Homologene: 81913
Steap2
Name: six transmembrane epithelial antigen of prostate 2
Synonyms: 4921538B17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74051
Homologene: 17682
Glg1
Name: golgi apparatus protein 1
Synonyms: ESL-1, CFR, MG-160, MG160, CFR-1, Selel
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Ctsc
Name: cathepsin C
Synonyms: DPP1, dipeptidylpeptidase 1, DPPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13032
HGNC: HGNC:2528
Homologene: 1373
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20498
Homologene: 21056
Tmco1
Name: transmembrane and coiled-coil domains 1
Synonyms: ESTM39, 1190006A08Rik, 4930403O06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68944
Homologene: 10384
Usp8
Name: ubiquitin specific peptidase 8
Synonyms: Ubpy
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 84092
Homologene: 3782
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: Epac2, cAMP-GEFII, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Gorasp1
Name: golgi reassembly stacking protein 1
Synonyms: 5430411C10Rik, GRASP65, GOLPH5, P65
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74498
VEGA: 9
Homologene: 49916
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Cdhr2
Name: cadherin-related family member 2
Synonyms: LOC268663, Pcdh24
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
Alox5ap
Name: arachidonate 5-lipoxygenase activating protein
Synonyms: arachidonate 5 lipoxygenase activating protein, Flap
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11690
HGNC: HGNC:436
Homologene: 1231
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, SUR2A, Sur2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Tas2r135
Name: taste receptor, type 2, member 135
Synonyms: mt2r38, Tas2r35
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387512
Homologene: 52230
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
Gsta5
Name: glutathione S-transferase alpha 5
Synonyms: Gm10639
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100042314
Homologene: 74378
Adamts15
Name: ADAM metallopeptidase with thrombospondin type 1 motif 15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235130
VEGA: 9
Homologene: 8610
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Mcam
Name: melanoma cell adhesion molecule
Synonyms: s-endo, CD146, s-gicerin, 1-gicerin, Muc18
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 84004
HGNC: HGNC:6934
Homologene: 4742
Krt12
Name: keratin 12
Synonyms: K12, Krt1-12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268482
HGNC: HGNC:6414
Homologene: 188
Vmn2r101
Name: vomeronasal 2, receptor 101
Synonyms: EG627576
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627576
Homologene: 115024
Dus2
Name: dihydrouridine synthase 2
Synonyms: 2310016K04Rik, Dus2l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66369
Homologene: 6838
Dnajb5
Name: DnaJ heat shock protein family (Hsp40) member B5
Synonyms: Hsp40-3, Hsc40, 1110058L06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56323
Homologene: 8176
Klk1b22
Name: kallikrein 1-related peptidase b22
Synonyms: mGk-22, Egfbp-1, Egfbp1, Klk22
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13646
Homologene: 68141
Mzf1
Name: myeloid zinc finger 1
Synonyms: Znf42, Mzf2, Zfp121, Zfp98
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109889
Homologene: 9633
Setbp1
Name: SET binding protein 1
Synonyms: Seb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240427
Homologene: 9192
Coro2a
Name: coronin, actin binding protein 2A
Synonyms: coronin 4, IR10, 9030208C03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107684
HGNC: HGNC:2255
Homologene: 2546
Krtap6-2
Name: keratin associated protein 6-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16701
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 135,955,590 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • A to G, chromosome 2 at 72,031,149 bp
  • T to C, chromosome 2 at 76,788,194 bp
  • T to C, chromosome 2 at 91,595,799 bp
  • T to A, chromosome 2 at 91,927,730 bp
  • A to G, chromosome 2 at 126,737,423 bp
  • T to A, chromosome 3 at 114,094,543 bp
  • T to C, chromosome 4 at 42,953,233 bp
  • C to T, chromosome 4 at 46,563,047 bp
  • G to A, chromosome 4 at 130,017,084 bp
  • A to G, chromosome 5 at 5,677,475 bp
  • A to G, chromosome 5 at 145,191,505 bp
  • T to C, chromosome 5 at 149,279,205 bp
  • T to C, chromosome 6 at 29,071,094 bp
  • T to G, chromosome 6 at 42,406,381 bp
  • A to T, chromosome 6 at 83,976,912 bp
  • T to A, chromosome 6 at 142,645,930 bp
  • T to A, chromosome 7 at 13,044,352 bp
  • G to A, chromosome 7 at 44,116,268 bp
  • C to A, chromosome 7 at 76,589,477 bp
  • A to T, chromosome 7 at 88,309,896 bp
  • G to T, chromosome 7 at 101,826,024 bp
  • T to C, chromosome 8 at 77,259,072 bp
  • T to C, chromosome 8 at 104,213,925 bp
  • A to G, chromosome 8 at 105,944,352 bp
  • C to T, chromosome 8 at 106,048,701 bp
  • A to T, chromosome 8 at 111,160,820 bp
  • T to C, chromosome 8 at 122,887,333 bp
  • A to G, chromosome 9 at 30,911,202 bp
  • T to C, chromosome 9 at 44,140,396 bp
  • A to T, chromosome 9 at 78,305,385 bp
  • A to G, chromosome 9 at 106,835,632 bp
  • A to G, chromosome 9 at 119,928,376 bp
  • G to A, chromosome 10 at 82,295,518 bp
  • G to A, chromosome 10 at 82,378,279 bp
  • T to C, chromosome 10 at 103,400,279 bp
  • A to G, chromosome 11 at 65,989,887 bp
  • A to G, chromosome 11 at 99,418,552 bp
  • C to T, chromosome 12 at 59,170,267 bp
  • A to T, chromosome 13 at 11,603,855 bp
  • A to G, chromosome 13 at 18,839,713 bp
  • A to G, chromosome 13 at 54,734,887 bp
  • T to C, chromosome 15 at 55,338,429 bp
  • T to C, chromosome 16 at 87,427,644 bp
  • GAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCGTATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAACCATAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCA to GAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCGTATCCACAGCCATAGCCAGAGCCATATCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAACCATAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCAGAGCCAGAGCCACAGCCATAGCCAGAGCCATAGCCACAGCCATAGCCA, chromosome 16 at 89,419,725 bp
  • A to G, chromosome 17 at 8,978,950 bp
  • A to G, chromosome 17 at 19,591,026 bp
  • A to G, chromosome 17 at 63,225,090 bp
  • C to T, chromosome 18 at 4,168,604 bp
  • G to T, chromosome 18 at 78,857,733 bp
  • T to C, chromosome 19 at 6,855,845 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9113 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068920-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.