Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9058Btlr/Mmmh
Stock Number:
068884-MU
Citation ID:
RRID:MMRRC_068884-MU
Other Names:
R9058 (G1)
Major Collection:

Strain Information

Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Alkbh5
Name: alkB homolog 5, RNA demethylase
Synonyms: Ofoxd, Abh5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268420
Homologene: 9818
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Puf60
Name: poly-U binding splicing factor 60
Synonyms: 2810454F19Rik, 2410104I19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67959
VEGA: 15
Homologene: 8614
Ntng2
Name: netrin G2
Synonyms: Lmnt2, 2610016D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 171171
Homologene: 13053
Nr5a1
Name: nuclear receptor subfamily 5, group A, member 1
Synonyms: Ad4BP, SF1, SF-1, Ftz-F1, steroidogenic factor 1, adrenal 4-binding protein, ELP, Ftzf1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26423
HGNC: HGNC:7983
Homologene: 3638
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik, Kirrel
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Tmco1
Name: transmembrane and coiled-coil domains 1
Synonyms: ESTM39, 1190006A08Rik, 4930403O06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68944
Homologene: 10384
Zfp142
Name: zinc finger protein 142
Synonyms: 9330177B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77264
Homologene: 3723
Hrob
Name: homologous recombination factor with OB-fold
Synonyms: BC030867
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217216
Homologene: 69368
Mideas
Name: mitotic deacetylase associated SANT domain protein
Synonyms: 9430029N19Rik, C130039O16Rik, Elmsan1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238317
Homologene: 19330
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Sv2b
Name: synaptic vesicle glycoprotein 2b
Synonyms: A830038F04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64176
Homologene: 32236
Nr4a2
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: HZF-3, RNR-1, Nurr1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18227
HGNC: HGNC:7981
Homologene: 4509
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Cfap299
Name: cilia and flagella associated protein 299
Synonyms: 1700007G11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75784
Homologene: 51893
Cpne8
Name: copine VIII
Synonyms: 1200003E11Rik, 1500031E20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66871
Homologene: 12049
Sync
Name: syncoilin
Synonyms: SNIP4, 1110057H03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68828
Homologene: 11351
Ccser1
Name: coiled-coil serine rich 1
Synonyms: 6230405M12Rik, C130092O11Rik, Fam190a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232035
Homologene: 28086
Bpifb5
Name: BPI fold containing family B, member 5
Synonyms: BC018465
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228802
Homologene: 64814
Vmn2r19
Name: vomeronasal 2, receptor 19
Synonyms: EG232358
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232358
Homologene: 84037
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Gbe1
Name: 1,4-alpha-glucan branching enzyme 1
Synonyms: 2310045H19Rik, 2810426P10Rik, D16Ertd536e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74185
HGNC: HGNC:4180
Homologene: 129
Serpina1a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1A
Synonyms: PI1, Aat-2, Spi1-1, Aat2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20700
HGNC: HGNC:8941
Homologene: 20103
Prkch
Name: protein kinase C, eta
Synonyms: Pkch
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18755
HGNC: HGNC:9403
Homologene: 84384
Ctnnb1
Name: catenin beta 1
Synonyms: beta-catenin, Catnb, beta catenin, catenin (cadherin associated protein), beta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12387
HGNC: HGNC:2514
Homologene: 1434
Frmpd1
Name: FERM and PDZ domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666060
Homologene: 8939
Aldh8a1
Name: aldehyde dehydrogenase 8 family, member A1
Synonyms: RALDH4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237320
Homologene: 23369
Syt16
Name: synaptotagmin XVI
Synonyms: Strep14, syt14r, Syt14l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238266
VEGA: 12
Homologene: 12902
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Cebpz
Name: CCAAT/enhancer binding protein zeta
Synonyms: Cbf, CBF2, Cebpa-rs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12607
VEGA: 17
Homologene: 4210
Phldb2
Name: pleckstrin homology like domain, family B, member 2
Synonyms: LL5beta, LL5b, C820004H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208177
Homologene: 17100
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Grep1
Name: glycine rich extracellular protein 1
Synonyms: 1520401A03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320309
Rmnd1
Name: required for meiotic nuclear division 1 homolog
Synonyms: 0610042C05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66084
Homologene: 5675
Zfp936
Name: zinc finger protein 936
Synonyms: EG435970, Gm9272, I1C0022H11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 668620
Or5b119
Name: olfactory receptor family 5 subfamily B member 119
Synonyms: GA_x6K02T2RE5P-3812807-3811863, MOR202-36, Olfr1475
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258298
Homologene: 77370
Or7g12
Name: olfactory receptor family 7 subfamily G member 12
Synonyms: GA_x6K02T2PVTD-12724921-12725859, MOR153-2, MOR153-4_p, Olfr834
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258074
HGNC: HGNC:8467
Homologene: 128143
Phc2
Name: polyhomeotic 2
Synonyms: Mph2, D4Ertd810e, Edr2, D130050K19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54383
HGNC: HGNC:3183
Homologene: 75090
Tmem19
Name: transmembrane protein 19
Synonyms: 2810428F02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67226
VEGA: 10
Homologene: 10107
Acox1
Name: acyl-Coenzyme A oxidase 1, palmitoyl
Synonyms: Acyl-CoA oxidase, AOX, D130055E20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11430
HGNC: HGNC:119
Homologene: 38299
Klk15
Name: kallikrein related-peptidase 15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317652
Homologene: 77571
Adrm1b
Name: adhesion regulating molecule 1B
Synonyms: Gm9774
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100043022
Fam47e
Name: family with sequence similarity 47, member E
Synonyms: LOC384198, Gm1381
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384198
Homologene: 129958
Socs1
Name: suppressor of cytokine signaling 1
Synonyms: SSI-1, JAK2-binding protein, STAT-induced STAT inhibitor 1, JAK-binding protein, JAB, Cish7, Cish1, SOCS-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12703
VEGA: 16
Homologene: 2776
Or4p23
Name: olfactory receptor family 4 subfamily P member 23
Synonyms: GA_x6K02T2Q125-50221692-50220766, MOR225-13, Olfr1198
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404330
Homologene: 138634
Arhgap8
Name: Rho GTPase activating protein 8
Synonyms: 3110043J09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73167
Homologene: 23645
Tbx20
Name: T-box 20
Synonyms: Tbx12, 9430010M06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57246
VEGA: 9
Homologene: 32476
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Exoc3l2
Name: exocyst complex component 3-like 2
Synonyms: 4933417E01Rik, Gm19857
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74463
Homologene: 16328
Hsfy2
Name: heat shock transcription factor, Y-linked 2
Synonyms: 4933413G11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71066
Homologene: 134090
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: 2610507K20Rik, UT-B, 3021401A05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108052
Homologene: 9285
Hps4
Name: HPS4, biogenesis of lysosomal organelles complex 3 subunit 2
Synonyms: C130020P05Rik, BLOC-3, 2010205O06Rik, Hermansky-Pudlak syndrome 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192232
Homologene: 11123
Efna2
Name: ephrin A2
Synonyms: Elf-1, Ephrin-A2, Epl6, ephrin A6, LERK-6, Cek7-L
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13637
HGNC: HGNC:3222
Homologene: 1075
Sds
Name: serine dehydratase
Synonyms: SDH
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231691
Homologene: 38235
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Krtap10-28
Name: keratin associated protein 10-28
Synonyms: Gm9508
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 670895
VEGA: 10
Homologene: 115744
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 14,889,394 bp
  • A to G, chromosome 1 at 46,243,415 bp
  • G to T, chromosome 1 at 46,766,656 bp
  • A to T, chromosome 1 at 56,637,345 bp
  • A to T, chromosome 1 at 74,569,796 bp
  • A to T, chromosome 1 at 136,070,698 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • A to G, chromosome 2 at 29,204,190 bp
  • G to A, chromosome 2 at 31,908,641 bp
  • T to C, chromosome 2 at 38,694,022 bp
  • T to C, chromosome 2 at 52,185,329 bp
  • T to C, chromosome 2 at 57,112,243 bp
  • A to C, chromosome 2 at 88,746,686 bp
  • T to A, chromosome 2 at 144,582,090 bp
  • A to G, chromosome 2 at 154,238,897 bp
  • A to G, chromosome 3 at 87,085,135 bp
  • A to T, chromosome 3 at 92,428,252 bp
  • T to A, chromosome 4 at 45,283,948 bp
  • T to A, chromosome 4 at 128,722,976 bp
  • T to C, chromosome 4 at 129,293,424 bp
  • A to G, chromosome 5 at 92,571,508 bp
  • A to T, chromosome 5 at 98,784,541 bp
  • G to A, chromosome 5 at 112,378,039 bp
  • C to A, chromosome 5 at 114,415,239 bp
  • A to G, chromosome 5 at 120,480,714 bp
  • G to T, chromosome 5 at 123,614,582 bp
  • T to C, chromosome 6 at 61,373,992 bp
  • T to A, chromosome 6 at 123,336,062 bp
  • A to T, chromosome 7 at 19,469,896 bp
  • A to T, chromosome 7 at 43,189,772 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • A to T, chromosome 7 at 75,140,074 bp
  • T to A, chromosome 7 at 105,684,063 bp
  • G to C, chromosome 7 at 141,638,241 bp
  • T to C, chromosome 8 at 66,703,948 bp
  • A to T, chromosome 8 at 94,512,310 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 18,988,926 bp
  • T to C, chromosome 9 at 24,769,723 bp
  • T to C, chromosome 9 at 55,815,478 bp
  • T to A, chromosome 9 at 120,951,410 bp
  • T to C, chromosome 10 at 4,413,398 bp
  • T to C, chromosome 10 at 21,382,445 bp
  • G to A, chromosome 10 at 77,696,786 bp
  • A to G, chromosome 10 at 80,186,886 bp
  • C to A, chromosome 10 at 115,362,126 bp
  • T to C, chromosome 11 at 48,895,222 bp
  • T to C, chromosome 11 at 60,553,722 bp
  • T to C, chromosome 11 at 102,255,560 bp
  • G to T, chromosome 11 at 106,699,849 bp
  • T to C, chromosome 11 at 116,189,442 bp
  • G to T, chromosome 12 at 73,775,534 bp
  • T to A, chromosome 12 at 74,235,245 bp
  • A to G, chromosome 12 at 84,173,868 bp
  • A to T, chromosome 12 at 103,853,742 bp
  • T to C, chromosome 13 at 46,791,465 bp
  • C to T, chromosome 15 at 76,070,576 bp
  • C to T, chromosome 15 at 76,072,533 bp
  • C to T, chromosome 15 at 76,108,065 bp
  • T to A, chromosome 15 at 76,880,781 bp
  • A to G, chromosome 15 at 84,757,040 bp
  • T to A, chromosome 15 at 90,497,073 bp
  • G to A, chromosome 16 at 10,784,828 bp
  • T to A, chromosome 16 at 45,772,241 bp
  • A to G, chromosome 16 at 70,527,171 bp
  • T to C, chromosome 17 at 23,716,042 bp
  • A to T, chromosome 17 at 78,935,798 bp
  • T to A, chromosome 18 at 78,102,570 bp
  • G to A, chromosome 19 at 13,479,592 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9058 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068884-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.