Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8874Btlr/Mmmh
Stock Number:
068744-MU
Citation ID:
RRID:MMRRC_068744-MU
Other Names:
R8874 (G1)
Major Collection:

Strain Information

Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Kpnb1
Name: karyopherin subunit beta 1
Synonyms: Impnb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16211
HGNC: HGNC:6400
Homologene: 1707
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Sf3a2
Name: splicing factor 3a, subunit 2
Synonyms: SFA66, PRP11, Sap62, 66kDa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20222
Homologene: 133823
Heatr1
Name: HEAT repeat containing 1
Synonyms: B130016L12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217995
VEGA: 13
Homologene: 34562
Uvrag
Name: UV radiation resistance associated gene
Synonyms: 9530039D02Rik, Uvragl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78610
Homologene: 31150
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: SPAG13, CS-1, CS1, KRAP, Ssfa2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70599
Homologene: 4912
Rad17
Name: RAD17 checkpoint clamp loader component
Synonyms: MmRad24, 9430035O09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19356
VEGA: 13
HGNC: HGNC:9807
Homologene: 32117
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Jph4
Name: junctophilin 4
Synonyms: JPHL1, JP-4, 9330157P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319984
Homologene: 13034
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Lca5
Name: Leber congenital amaurosis 5 (human)
Synonyms: 5730406O13Rik, ORF64, 4930431B11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75782
Homologene: 32718
Cpxm2
Name: carboxypeptidase X, M14 family member 2
Synonyms: 4632435C11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55987
Homologene: 69259
Map2
Name: microtubule-associated protein 2
Synonyms: MAP-2, G1-397-34, Mtap2, repro4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Med23
Name: mediator complex subunit 23
Synonyms: ESTM7, 3000002A17Rik, X83317, Crsp3, Sur2, sno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Taf4b
Name: TATA-box binding protein associated factor 4b
Synonyms: Taf2c2, TAFII105, 105kDa, 2610524B04Rik, 4932409F03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72504
VEGA: 18
Homologene: 28266
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Vwa3b
Name: von Willebrand factor A domain containing 3B
Synonyms: A230074B11Rik, 4921511C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70853
Homologene: 27053
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Myo1h
Name: myosin 1H
Synonyms: 4631401O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231646
Homologene: 82639
Ghrhr
Name: growth hormone releasing hormone receptor
Synonyms: Ghrfr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14602
HGNC: HGNC:4266
Homologene: 640
Hecw2
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
Synonyms: D030049F17Rik, Nedl2, A730039N16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329152
Homologene: 66192
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Myom1
Name: myomesin 1
Synonyms: skelemin, D430047A17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17929
VEGA: 17
HGNC: HGNC:7613
Homologene: 31196
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Or7e177
Name: olfactory receptor family 7 subfamily E member 177
Synonyms: GA_x6K02T2PVTD-14040245-14041204, MOR145-2, Olfr873
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258554
HGNC: HGNC:8396
Homologene: 115528
Klhdc7a
Name: kelch domain containing 7A
Synonyms: B230308G19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242721
Homologene: 17567
Ccdc42
Name: coiled-coil domain containing 42
Synonyms: A530001H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276920
Homologene: 44902
Hdgfl1
Name: HDGF like 1
Synonyms: HRP-1, Hdgfrp1, Pwwp1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15192
Homologene: 56406
Prr5
Name: proline rich 5 (renal)
Synonyms: C030017C09Rik, Protor-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109270
Homologene: 17132
Tgfbrap1
Name: transforming growth factor, beta receptor associated protein 1
Synonyms: 3110018K12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73122
Homologene: 3141
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Cenpq
Name: centromere protein Q
Synonyms: 2610528M18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83815
Homologene: 49525
Calhm4
Name: calcium homeostasis modulator family member 4
Synonyms: LOC270711, 4732454E20Rik, Fam26d
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270711
VEGA: 10
Homologene: 19551
Vmn2r8
Name: vomeronasal 2, receptor 8
Synonyms: EG627479
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627479
Homologene: 129606
Gbp2b
Name: guanylate binding protein 2b
Synonyms: Mag-1, Mpa-1, Gbp-1, Mpa1, LIMIT, Gbp1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14468
Homologene: 137233
Vmn2r76
Name: vomeronasal 2, receptor 76
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 675969
Homologene: 104330
Ptpn7
Name: protein tyrosine phosphatase, non-receptor type 7
Synonyms: LC-PTP, BPTP-4, C920001D21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320139
HGNC: HGNC:9659
Homologene: 15411
Slc22a2
Name: solute carrier family 22 (organic cation transporter), member 2
Synonyms: Oct2, Orct2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20518
VEGA: 17
Homologene: 68293
Or14j5
Name: olfactory receptor family 14 subfamily J member 5
Synonyms: MOR218-1, GA_x6K02T2PSCP-2307164-2308123, Olfr126
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258892
Homologene: 134080
Or2n1b
Name: olfactory receptor family 2 subfamily N member 1B
Synonyms: MOR256-6, GA_x6K02T2PSCP-2597192-2598130, Olfr133
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258828
Homologene: 110603
Efcab8
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100504221
Igkv8-30
Name: immunoglobulin kappa chain variable 8-30
Synonyms: ENSMUSG00000073025, Gm10883
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384419
HGNC: HGNC:5834
Diras2
Name: DIRAS family, GTP-binding RAS-like 2
Synonyms: 2900052J15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68203
VEGA: 13
Homologene: 56777
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 37,035,758 bp
  • T to A, chromosome 1 at 40,525,346 bp
  • A to C, chromosome 1 at 43,075,813 bp
  • A to T, chromosome 1 at 53,904,449 bp
  • A to T, chromosome 1 at 66,416,364 bp
  • T to C, chromosome 1 at 135,139,266 bp
  • A to G, chromosome 1 at 140,086,421 bp
  • T to C, chromosome 2 at 13,360,346 bp
  • A to G, chromosome 2 at 79,657,340 bp
  • C to T, chromosome 2 at 121,374,872 bp
  • T to A, chromosome 2 at 153,798,649 bp
  • G to C, chromosome 3 at 118,999,332 bp
  • A to G, chromosome 3 at 142,608,279 bp
  • A to T, chromosome 4 at 139,967,585 bp
  • A to T, chromosome 4 at 143,133,215 bp
  • T to C, chromosome 4 at 145,155,202 bp
  • A to G, chromosome 5 at 8,825,671 bp
  • T to C, chromosome 5 at 108,808,751 bp
  • A to T, chromosome 5 at 114,334,102 bp
  • T to C, chromosome 5 at 145,142,569 bp
  • T to A, chromosome 5 at 146,528,143 bp
  • T to C, chromosome 6 at 23,042,748 bp
  • T to C, chromosome 6 at 55,378,906 bp
  • C to A, chromosome 6 at 70,117,166 bp
  • T to C, chromosome 6 at 83,969,153 bp
  • A to G, chromosome 7 at 86,228,791 bp
  • A to G, chromosome 7 at 98,979,736 bp
  • A to T, chromosome 7 at 132,106,281 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 9 at 20,300,773 bp
  • A to G, chromosome 9 at 83,395,450 bp
  • A to G, chromosome 10 at 24,895,719 bp
  • A to G, chromosome 10 at 34,044,268 bp
  • ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT to ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT, chromosome 10 at 80,804,437 bp
  • A to G, chromosome 11 at 68,594,570 bp
  • A to G, chromosome 11 at 72,863,989 bp
  • T to C, chromosome 11 at 97,165,383 bp
  • T to C, chromosome 12 at 85,069,620 bp
  • T to A, chromosome 13 at 12,430,912 bp
  • T to C, chromosome 13 at 13,637,562 bp
  • T to G, chromosome 13 at 26,770,024 bp
  • A to G, chromosome 13 at 48,590,692 bp
  • T to C, chromosome 13 at 52,507,701 bp
  • G to T, chromosome 13 at 100,617,819 bp
  • T to C, chromosome 14 at 55,114,077 bp
  • T to C, chromosome 15 at 84,699,715 bp
  • A to G, chromosome 15 at 86,100,892 bp
  • A to T, chromosome 17 at 12,609,979 bp
  • A to T, chromosome 17 at 37,850,784 bp
  • T to A, chromosome 17 at 38,148,732 bp
  • A to G, chromosome 17 at 40,931,660 bp
  • A to G, chromosome 17 at 71,106,204 bp
  • A to T, chromosome 18 at 10,544,896 bp
  • T to C, chromosome 18 at 12,449,586 bp
  • T to G, chromosome 18 at 14,830,070 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8874 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068744-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.