Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8710Btlr/Mmmh
Stock Number:
068564-MU
Citation ID:
RRID:MMRRC_068564-MU
Other Names:
R8710 (G1)
Major Collection:

Strain Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Agpat5
Name: 1-acylglycerol-3-phosphate O-acyltransferase 5
Synonyms: 1110013A05Rik, D8Ertd319e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52123
Homologene: 10153
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Tjp2
Name: tight junction protein 2
Synonyms: ZO-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21873
VEGA: 19
Homologene: 3541
Cadm1
Name: cell adhesion molecule 1
Synonyms: 3100001I08Rik, 2900073G06Rik, RA175N, RA175C, RA175B, RA175A, Necl2, SgIGSF, Tslc1, SynCam, Igsf4, Igsf4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54725
HGNC: HGNC:5951
Homologene: 8641
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Anks3
Name: ankyrin repeat and sterile alpha motif domain containing 3
Synonyms: 2700067D09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72615
VEGA: 16
Homologene: 12475
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Slc25a13
Name: solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonyms: Ctrn, citrin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50799
Homologene: 22800
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117599
Homologene: 50463
Ermardl2
Name: ER membrane associated RNA degradation like 2
Synonyms: D17Zt9e, 9030025P20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100041574
VEGA: 17
Homologene: 104886
Iqgap2
Name: IQ motif containing GTPase activating protein 2
Synonyms: 4933417J23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544963
VEGA: 13
HGNC: HGNC:6111
Homologene: 101543
Camkmt
Name: calmodulin-lysine N-methyltransferase
Synonyms: 1700106N22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73582
VEGA: 17
Homologene: 11704
Rtca
Name: RNA 3'-terminal phosphate cyclase
Synonyms: 2310009A18Rik, Rtcd1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66368
Homologene: 2766
Asb6
Name: ankyrin repeat and SOCS box-containing 6
Synonyms: 2510004M11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72323
Homologene: 9895
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: 5230400C17Rik, Pip5k3, PipkIII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Rasal1
Name: RAS protein activator like 1 (GAP1 like)
Synonyms: MRASAL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19415
HGNC: HGNC:9873
Homologene: 3423
Zfp592
Name: zinc finger protein 592
Synonyms: A730014M16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233410
Homologene: 8759
Cd300a
Name: CD300A molecule
Synonyms: Pigr4, MMAC8, Clm8, LMIR1, B230315M08Rik, MAIR-I
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217303
Homologene: 48514
Cthrc1
Name: collagen triple helix repeat containing 1
Synonyms: 1110014B07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68588
Homologene: 16320
Cdc25c
Name: cell division cycle 25C
Synonyms: Cdc25
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12532
VEGA: 18
HGNC: HGNC:1727
Homologene: 1356
Zfp644
Name: zinc finger protein 644
Synonyms: 1110068L01Rik, BM-005, Zep-2, D5Ertd689e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52397
Homologene: 12971
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214764
Homologene: 27985
Rnf214
Name: ring finger protein 214
Synonyms: D130054N24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235315
Homologene: 109357
Tapt1
Name: transmembrane anterior posterior transformation 1
Synonyms: 4932414K18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231225
Homologene: 80206
Nsl1
Name: NSL1, MIS12 kinetochore complex component
Synonyms: LOC381318, 4833432M17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381318
Homologene: 22898
Tmem139
Name: transmembrane protein 139
Synonyms: A930027H06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109218
VEGA: 6
Homologene: 51920
Kifc5b
Name: kinesin family member C5B
Synonyms: kinesin family c-terminal 5B
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16580
VEGA: 17
HGNC: HGNC:6389
Homologene: 83229
Slc5a2
Name: solute carrier family 5 (sodium/glucose cotransporter), member 2
Synonyms: Sglt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246787
Homologene: 2289
Abcb4
Name: ATP-binding cassette, sub-family B member 4
Synonyms: mdr-2, Mdr2, Pgy-2, Pgy2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Efcab6
Name: EF-hand calcium binding domain 6
Synonyms: 4932408N08Rik, 4931407K02Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77627
Homologene: 11259
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Ralgps1
Name: Ral GEF with PH domain and SH3 binding motif 1
Synonyms: RALGPS1A, RALGEF2, 5830418G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241308
Homologene: 65163
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Mapkapk2
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17164
HGNC: HGNC:6887
Homologene: 56412
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Wdpcp
Name: WD repeat containing planar cell polarity effector
Synonyms: homoloc-13, AV249152
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216560
Homologene: 9299
Ttc23l
Name: tetratricopeptide repeat domain 23-like
Synonyms: 4930401A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75777
Homologene: 44907
Oas1e
Name: 2'-5' oligoadenylate synthetase 1E
Synonyms: 2'-5' oligoadenylate synthetase-like 7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231699
HGNC: HGNC:8086
Homologene: 110815
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Myh4
Name: myosin, heavy polypeptide 4, skeletal muscle
Synonyms: MyHC-IIb, MHC2B, Myhsf, MM, MYH-2B, Minmus, Minimsc
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17884
HGNC: HGNC:7574
Homologene: 123880
Cyld
Name: CYLD lysine 63 deubiquitinase
Synonyms: CYLD1, 2010013M14Rik, C130039D01Rik, 2900009M21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74256
HGNC: HGNC:2584
Homologene: 9069
Or14j2
Name: olfactory receptor family 14 subfamily J member 2
Synonyms: MOR218-9, GA_x6K02T2PSCP-2034880-2033942, Olfr113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258286
Cd69
Name: CD69 antigen
Synonyms: VEA, AIM, 5830438K24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12515
HGNC: HGNC:1694
Homologene: 128584
Clnk
Name: cytokine-dependent hematopoietic cell linker
Synonyms: MIST
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27278
Homologene: 8450
Tmc4
Name: transmembrane channel-like gene family 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 353499
Homologene: 16971
Ano5
Name: anoctamin 5
Synonyms: Gdd1, Tmem16e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233246
Homologene: 100071
Fam83c
Name: family with sequence similarity 83, member C
Synonyms: 5530400B04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71405
Homologene: 18669
Zfp983
Name: zinc finger protein 983
Synonyms: 3110052M02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73229
VEGA: 17
Plekha8
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
Synonyms: FAPP2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231999
Homologene: 32284
Ssh3
Name: slingshot protein phosphatase 3
Synonyms: SSH-3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 245857
VEGA: 19
Homologene: 32372
Or8c15
Name: olfactory receptor family 8 subfamily C member 15
Synonyms: GA_x6K02T2PVTD-31889215-31890153, MOR170-11, Olfr893
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258333
Homologene: 133626
Skint11
Name: selection and upkeep of intraepithelial T cells 11
Synonyms: A630098G03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230623
Homologene: 136292
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21892
Homologene: 49202
Bend7
Name: BEN domain containing 7
Synonyms: 1110017O21Rik, E130319B15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209645
Homologene: 17660
Trim35
Name: tripartite motif-containing 35
Synonyms: Mair, 0710005M05Rik, A430106H13Rik, Hls5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66854
Homologene: 134331
Lag3
Name: lymphocyte-activation gene 3
Synonyms: CD223, Ly66, LAG-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16768
HGNC: HGNC:6476
Homologene: 1719
Mettl4
Name: methyltransferase 4, N6-adenosine
Synonyms: HsT661, 2410198H06Rik, A730091E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76781
VEGA: 17
Homologene: 35305
Or8g18
Name: olfactory receptor family 8 subfamily G member 18
Synonyms: MOR171-41P, GA_x6K02T2PVTD-32935684-32934749, K4, MOR171-32P, MOR171-32P, Olfr144, Olfr1537-ps1, Olfr1537
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257959
VEGA: 9
HGNC: HGNC:8484
Homologene: 110610
Ttc9c
Name: tetratricopeptide repeat domain 9C
Synonyms: 2210019E14Rik, 6330408J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70387
Homologene: 18361
Gm38119
Name: predicted gene, 38119
Type: Gene
Species: Mouse
Chromosome: 3
Or1e1b
Name: olfactory receptor family 1 subfamily E member 1B
Synonyms: MTPCR35, MOR135-18, GA_x6K02T2P1NL-4111497-4112433, Or1e1b-ps1, Olfr22-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258209
Krtap7-1
Name: keratin associated protein 7-1
Synonyms: 5430433J05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71363
VEGA: 16
Homologene: 104469
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 65,215,996 bp
  • A to G, chromosome 1 at 75,492,682 bp
  • C to A, chromosome 1 at 131,058,711 bp
  • T to C, chromosome 1 at 181,690,311 bp
  • A to C, chromosome 1 at 185,295,586 bp
  • C to A, chromosome 1 at 191,063,223 bp
  • A to G, chromosome 2 at 4,763,114 bp
  • G to T, chromosome 2 at 30,827,060 bp
  • G to A, chromosome 2 at 33,145,421 bp
  • A to G, chromosome 2 at 155,829,722 bp
  • ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA to ACTGCCACCACTGCTGCCACAGCAGCCACTGCTGCCACCACTACTGCCACAGCAGCCACTGCTGCCACCACTGCTGCCACA, chromosome 3 at 92,737,890 bp
  • A to T, chromosome 3 at 116,497,654 bp
  • A to T, chromosome 4 at 113,626,590 bp
  • A to G, chromosome 4 at 114,194,754 bp
  • A to G, chromosome 5 at 8,955,495 bp
  • C to T, chromosome 5 at 35,873,174 bp
  • A to C, chromosome 5 at 38,774,597 bp
  • A to G, chromosome 5 at 44,194,401 bp
  • G to T, chromosome 5 at 101,882,483 bp
  • T to G, chromosome 5 at 106,635,131 bp
  • A to T, chromosome 5 at 120,662,937 bp
  • T to A, chromosome 5 at 120,791,962 bp
  • A to T, chromosome 6 at 6,114,238 bp
  • A to G, chromosome 6 at 42,264,087 bp
  • A to G, chromosome 6 at 54,622,260 bp
  • G to A, chromosome 6 at 124,908,445 bp
  • A to T, chromosome 6 at 129,269,610 bp
  • A to T, chromosome 6 at 142,253,102 bp
  • G to T, chromosome 7 at 3,675,464 bp
  • T to G, chromosome 7 at 51,593,671 bp
  • T to C, chromosome 7 at 81,023,573 bp
  • T to C, chromosome 7 at 128,265,794 bp
  • A to G, chromosome 7 at 133,643,766 bp
  • T to A, chromosome 8 at 18,878,089 bp
  • A to G, chromosome 8 at 64,124,906 bp
  • C to T, chromosome 8 at 87,780,921 bp
  • A to G, chromosome 8 at 88,709,895 bp
  • A to T, chromosome 9 at 22,026,553 bp
  • C to T, chromosome 9 at 38,209,770 bp
  • T to A, chromosome 9 at 39,238,010 bp
  • T to A, chromosome 9 at 45,867,450 bp
  • T to A, chromosome 9 at 47,848,168 bp
  • A to T, chromosome 9 at 96,002,232 bp
  • T to A, chromosome 10 at 8,780,521 bp
  • A to G, chromosome 10 at 51,725,405 bp
  • A to G, chromosome 10 at 61,347,453 bp
  • T to C, chromosome 10 at 107,576,058 bp
  • A to G, chromosome 10 at 120,105,967 bp
  • C to A, chromosome 11 at 21,660,924 bp
  • A to G, chromosome 11 at 67,252,332 bp
  • G to A, chromosome 11 at 73,954,868 bp
  • A to G, chromosome 11 at 114,894,675 bp
  • A to C, chromosome 11 at 118,042,147 bp
  • A to G, chromosome 11 at 120,284,127 bp
  • T to G, chromosome 13 at 95,660,248 bp
  • T to C, chromosome 14 at 66,307,918 bp
  • A to G, chromosome 15 at 10,539,935 bp
  • T to A, chromosome 15 at 39,084,426 bp
  • A to G, chromosome 15 at 84,018,648 bp
  • A to C, chromosome 16 at 4,958,112 bp
  • T to A, chromosome 16 at 89,508,120 bp
  • A to T, chromosome 17 at 14,988,932 bp
  • A to T, chromosome 17 at 21,661,318 bp
  • T to A, chromosome 17 at 26,920,906 bp
  • G to T, chromosome 17 at 37,574,649 bp
  • T to C, chromosome 17 at 85,113,849 bp
  • A to G, chromosome 17 at 94,733,644 bp
  • T to A, chromosome 18 at 34,749,613 bp
  • G to T, chromosome 19 at 4,263,805 bp
  • T to C, chromosome 19 at 8,818,496 bp
  • T to C, chromosome 19 at 24,095,432 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8710 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068564-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.