Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8705Btlr/Mmmh
Stock Number:
068559-MU
Citation ID:
RRID:MMRRC_068559-MU
Other Names:
R8705 (G1)
Major Collection:

Strain Information

Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Ggnbp2
Name: gametogenetin binding protein 2
Synonyms: DIF-3, Zfp403, D330017P12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217039
Homologene: 11750
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Prrc2a
Name: proline-rich coiled-coil 2A
Synonyms: G2, Bat-2, D17H6S51E, Wbp12, 3110039B05Rik, Bat2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 53761
Homologene: 10567
Hnrnpd
Name: heterogeneous nuclear ribonucleoprotein D
Synonyms: Auf1, Hnrpd
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11991
HGNC: HGNC:5036
Homologene: 22410
Traf3
Name: TNF receptor-associated factor 3
Synonyms: LAP1, CAP-1, CD40bp, CRAF1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22031
Homologene: 7981
Frzb
Name: frizzled-related protein
Synonyms: fritz, frzb-1, Sfrp3, Frp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20378
HGNC: HGNC:3959
Homologene: 1126
Ubxn11
Name: UBX domain protein 11
Synonyms: 4930506L07Rik, Soci, Ubxd5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67586
Homologene: 12159
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Kank1
Name: KN motif and ankyrin repeat domains 1
Synonyms: D330024H06Rik, A930031B09Rik, Ankrd15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107351
Homologene: 17706
Napb
Name: N-ethylmaleimide sensitive fusion protein attachment protein beta
Synonyms: SNARE, b-SNAP, I47, E161, Brp14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17957
Homologene: 5332
Hsd17b11
Name: hydroxysteroid (17-beta) dehydrogenase 11
Synonyms: Pan1b, retSDR2, Dhrs8, 17beta-HSD11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114664
Homologene: 69209
Rab9
Name: RAB9, member RAS oncogene family
Synonyms: SID 99, 2410064E05Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 56382
HGNC: HGNC:9792
Homologene: 20900
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Slc7a2
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 2
Synonyms: Tea, Atrc2, Cat2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11988
Homologene: 20659
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Sh3rf1
Name: SH3 domain containing ring finger 1
Synonyms: Posh, 2200003J05Rik, Sh3md2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59009
Homologene: 10988
Cyp2c70
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226105
Homologene: 120027
Gas6
Name: growth arrest specific 6
Synonyms: growth arrest-specific, GAS 6, Gas-6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14456
HGNC: HGNC:4168
Homologene: 638
Zfp654
Name: zinc finger protein 654
Synonyms: 1810008K20Rik, 1600021C16Rik, Gm5488
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72020
Homologene: 10114
Ly75
Name: lymphocyte antigen 75
Synonyms: DEC-205, CD205
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17076
Homologene: 31085
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Ces1c
Name: carboxylesterase 1C
Synonyms: Es-N, Es-4, Es-1, Ee-1, Es1, Ces-N
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13884
HGNC: HGNC:1863
Homologene: 117484
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232367
Sox5
Name: SRY (sex determining region Y)-box 5
Synonyms: A730017D01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20678
Homologene: 21378
Hyal6
Name: hyaluronoglucosaminidase 6
Synonyms: 4932701A20Rik, Hyal-ps1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74409
HGNC: HGNC:5324
Homologene: 78028
Wfdc16
Name: WAP four-disulfide core domain 16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277345
Homologene: 86739
Gdf7
Name: growth differentiation factor 7
Synonyms: BMP12
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238057
VEGA: 12
HGNC: HGNC:4222
Homologene: 32177
Or52e8
Name: olfactory receptor family 52 subfamily E member 8
Synonyms: GA_x6K02T2PBJ9-7604826-7603885, MOR32-12, Olfr671
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257910
Homologene: 133595
Akr1c6
Name: aldo-keto reductase family 1, member C6
Synonyms: estradiol 17-beta-dehydrogenase (A-specific), 3alpha-HSD, Akr1c1, Hsd17b5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 83702
Homologene: 84695
Sf3b5
Name: splicing factor 3b, subunit 5
Synonyms: 10kDa, 1110005L13Rik, Sf3b10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66125
Homologene: 41825
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353235
HGNC: HGNC:8675
Homologene: 129614
Igkv5-43
Name: immunoglobulin kappa chain variable 5-43
Synonyms: Igk-V23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381783
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 51,863,336 bp
  • T to C, chromosome 2 at 52,258,783 bp
  • A to T, chromosome 2 at 60,318,385 bp
  • G to A, chromosome 2 at 80,446,897 bp
  • A to G, chromosome 2 at 148,700,476 bp
  • T to A, chromosome 2 at 164,638,475 bp
  • C to T, chromosome 2 at 180,178,561 bp
  • A to T, chromosome 4 at 134,126,240 bp
  • A to T, chromosome 5 at 96,691,401 bp
  • A to G, chromosome 5 at 99,963,729 bp
  • G to A, chromosome 5 at 103,992,837 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • G to A, chromosome 6 at 24,734,674 bp
  • T to C, chromosome 6 at 37,903,653 bp
  • A to G, chromosome 6 at 69,823,608 bp
  • C to G, chromosome 6 at 99,016,546 bp
  • C to T, chromosome 6 at 124,230,229 bp
  • T to C, chromosome 6 at 144,041,286 bp
  • T to C, chromosome 7 at 104,975,239 bp
  • T to A, chromosome 7 at 141,258,738 bp
  • A to T, chromosome 7 at 142,240,997 bp
  • T to C, chromosome 8 at 13,475,156 bp
  • A to T, chromosome 8 at 40,914,995 bp
  • T to C, chromosome 8 at 61,349,557 bp
  • A to G, chromosome 8 at 93,130,890 bp
  • T to C, chromosome 9 at 82,893,559 bp
  • G to A, chromosome 9 at 108,580,041 bp
  • G to T, chromosome 10 at 13,008,810 bp
  • A to G, chromosome 11 at 84,862,306 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • C to T, chromosome 12 at 8,298,167 bp
  • A to G, chromosome 12 at 111,242,504 bp
  • G to T, chromosome 13 at 4,434,448 bp
  • G to A, chromosome 15 at 101,938,006 bp
  • A to G, chromosome 16 at 64,785,070 bp
  • G to T, chromosome 17 at 34,049,795 bp
  • A to G, chromosome 17 at 35,153,566 bp
  • T to A, chromosome 18 at 36,993,853 bp
  • A to G, chromosome 19 at 25,411,543 bp
  • A to G, chromosome 19 at 40,180,504 bp
  • C to T, chromosome X at 166,457,758 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8705 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068559-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.