Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8545Btlr/Mmmh
Stock Number:
068510-MU
Citation ID:
RRID:MMRRC_068510-MU
Other Names:
R8545 (G1)
Major Collection:

Strain Information

Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Il17rd
Name: interleukin 17 receptor D
Synonyms: Sef, Sef-S, 2810004A10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 171463
VEGA: 14
Homologene: 9717
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Dph6
Name: diphthamine biosynthesis 6
Synonyms: 5730421E18Rik, Diphthine ammonia ligase, Atpbd4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66632
Homologene: 80244
Eftud2
Name: elongation factor Tu GTP binding domain containing 2
Synonyms: U5-116kD, 116kDa, Snrp116
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20624
Homologene: 3133
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: mZ13, Miz1, Zfp100
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22642
Homologene: 2575
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Pcdh20
Name: protocadherin 20
Synonyms: PCDH13, C630015B17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219257
Homologene: 11277
Muc15
Name: mucin 15
Synonyms: D730046L02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269328
Homologene: 51680
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Tbccd1
Name: TBCC domain containing 1
Synonyms: 5730478M09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70573
VEGA: 16
Homologene: 32392
Arhgap30
Name: Rho GTPase activating protein 30
Synonyms: 6030405P05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226652
Homologene: 18766
Hgsnat
Name: heparan-alpha-glucosaminide N-acetyltransferase
Synonyms: 9430010M12Rik, D8Ertd354e, Tmem76
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52120
Homologene: 15586
Pigg
Name: phosphatidylinositol glycan anchor biosynthesis, class G
Synonyms: Gpi7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433931
Homologene: 39421
Tapbp
Name: TAP binding protein
Synonyms: tapasin, TPN, D17Wsu91e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21356
Homologene: 2401
Pcnx4
Name: pecanex homolog 4
Synonyms: 1810048J11Rik, Pcnxl4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Zfp646
Name: zinc finger protein 646
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233905
Homologene: 8802
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Zcchc4
Name: zinc finger, CCHC domain containing 4
Synonyms: 4930449I23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78796
Homologene: 14632
Cox15
Name: cytochrome c oxidase assembly protein 15
Synonyms: 2900026G05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226139
HGNC: HGNC:2263
Homologene: 5848
Zfp820
Name: zinc finger protein 820
Synonyms: 2610036F08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75424
VEGA: 17
Arhgap31
Name: Rho GTPase activating protein 31
Synonyms: CdGAP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12549
Homologene: 10644
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Cyp4a12b
Name: cytochrome P450, family 4, subfamily a, polypeptide 12B
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13118
Homologene: 134044
Rnf148
Name: ring finger protein 148
Synonyms: Greul3, 4933432M07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71300
Homologene: 82404
Bbs2
Name: Bardet-Biedl syndrome 2
Synonyms: 2410125H22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67378
HGNC: HGNC:967
Homologene: 12122
Tmem109
Name: transmembrane protein 109
Synonyms: 1110006I15Rik, mitsugumin23, MG23
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68539
Homologene: 11458
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209601
Homologene: 27877
Cby3
Name: chibby family member 3
Synonyms: 1700121K02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76653
Homologene: 67734
Gm49368
Name: predicted gene, 49368
Type: Gene
Species: Mouse
Chromosome: 7
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 30,824,310 bp
  • T to C, chromosome 1 at 171,407,430 bp
  • A to T, chromosome 2 at 110,731,236 bp
  • G to A, chromosome 2 at 114,647,767 bp
  • A to T, chromosome 3 at 154,762,359 bp
  • A to T, chromosome 4 at 115,433,030 bp
  • CCCCCACCTCCACAGACCCCA to CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA, chromosome 4 at 141,466,828 bp
  • G to A, chromosome 5 at 52,819,399 bp
  • A to T, chromosome 5 at 108,341,860 bp
  • A to C, chromosome 5 at 140,300,494 bp
  • A to T, chromosome 6 at 23,654,571 bp
  • T to C, chromosome 7 at 29,004,814 bp
  • T to C, chromosome 7 at 127,885,490 bp
  • T to C, chromosome 7 at 128,080,261 bp
  • A to G, chromosome 7 at 141,752,393 bp
  • T to G, chromosome 8 at 14,928,868 bp
  • A to G, chromosome 8 at 14,975,931 bp
  • T to C, chromosome 8 at 25,955,679 bp
  • T to C, chromosome 8 at 94,086,724 bp
  • T to A, chromosome 9 at 66,371,975 bp
  • A to G, chromosome 10 at 40,847,943 bp
  • A to T, chromosome 10 at 62,812,939 bp
  • T to C, chromosome 11 at 50,359,416 bp
  • T to A, chromosome 11 at 67,202,201 bp
  • A to G, chromosome 11 at 84,345,968 bp
  • A to G, chromosome 11 at 102,840,271 bp
  • G to A, chromosome 12 at 72,556,082 bp
  • T to G, chromosome 14 at 27,091,929 bp
  • T to C, chromosome 14 at 33,078,301 bp
  • T to A, chromosome 14 at 88,469,165 bp
  • T to C, chromosome 16 at 22,834,029 bp
  • T to A, chromosome 16 at 38,603,046 bp
  • A to G, chromosome 17 at 21,819,457 bp
  • A to G, chromosome 17 at 33,920,317 bp
  • G to A, chromosome 18 at 20,034,665 bp
  • A to G, chromosome 18 at 34,317,031 bp
  • G to A, chromosome 19 at 10,874,370 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to T, chromosome 19 at 43,739,982 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8545 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068510-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.