Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Kcnb1em1Kea/Mmucd
Stock Number:
067994-UCD
Citation ID:
RRID:MMRRC_067994-UCD
Other Names:
Kcnb1-G379R

Strain Information

Kcnb1em1Kea
Name: potassium voltage gated channel, Shab-related subfamily, member 1; endonuclease-mediated mutation 1, Jennifer Kearney
Synonyms: Kcnb1R, Kcnb1G379R
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: CRISPR
Kcnb1
Name: potassium voltage gated channel, Shab-related subfamily, member 1
Synonyms: Kv2.1, Kcr1-1, Shab
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: CRISPR
NCBI: 16500
HGNC: HGNC:6231
Homologene: 37988
Genetic Alterations
CRISPR/Cas9-mediated homology-directed repair introducing three nucleotide changes, including two nucleotide changes to codon 379 (GGT>CGC) predicting the G379R substitution, and a silent change to disrupt an adjacent PAM site.

HGVS nomenclature:

  • Genbank RefSeq - mRNA: NM_008420.4
  • Genbank RefSeq, protein: NP_032446.2
  • Variant, nucleic acid level: c.1131_1137delinsAGTTCGC
  • Variant, amino acid level, predicted: p.Gly379Arg (G379R)
  • Check this variant: LUMC Mutalyzer

ES Cell Line
Not applicable
Phenotype
  • Homozygous: Spontaneous and handling-induced seizures, lower threshold to seizures induced by electroconvulsive stimulation or flurothyl, hyperactivity, impulsivity, and reduced anxiety.
  • Heterozygous: Handling-induced seizures, lower threshold to seizures induced by electroconvulsive stimulation or flurothyl, hyperactivity, impulsivity, and reduced anxiety.
Strain Development
CRISPR/Cas9 and homology-directed repair with sgRNA (TAGATGTCTCCGTAACCAA NGG) and repair oligo (5'-TCTCCAGCCTGGTCTTCTTTGCCGAGAAGGATGAGGATGACACCAAGTTCAAAAGCATCCCCGCCTCTTTCTGGTGGGCTACCATCACCATGACGACAGTTCGCTACGGAGACATCTACCCTAAGACTCTCCTGGGGAAAATCGTGGGGGGCCTCTGTTGCATTGCCGGTGTCCTGGTGATTGCCCTCCCCATTCCAATT, NCBI Gene ID 16500, NM_008420.4) with variants c.1130C>A, c.1135G>C, c.1137T>C, predicting p.Gly379Arg (G379R). Microinjection into C57BL/6J oocytes (RRID:IMSR_JAX:000664). Tail-snip PCR to confirm the genotype of the mosaic founders, followed by mating with C57BL/6J for germline transmission. Screening of the offspring to confirm the presence of the knock-in mutation and the absence of mutations at predicted off-target sites with less than 3 mismatches. Maintenance on C57BL/6J background.
Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.
  • Models for Human Disease
  • Neurobiology
Donor
Jennifer Kearney, Ph.D., Northwestern University.
Primary Reference

Hawkins NA, Misra SN, Jurado M, Kang SK, Vierra NC, Nguyen K, Wren L, George AL Jr, Trimmer JS, Kearney JA. Epilepsy and neurobehavioral abnormalities in mice with a dominant-negative KCNB1 pathogenic variant. Neurobiol Dis. 2021 Jan;147:105141. doi: 10.1016/j.nbd.2020.105141. Epub 2020 Oct 22. (Medline PMID: 33132203)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Generation
N9 (C57BL/6J)
Overall Breeding Performance
Excellent
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 7 to 9 months
Average litter size
4 to 6
Recommended wean age
3 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Gwendolyn Humphreys.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain. For more information, please contact Gwendolyn Humphreys

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067994-UCD-SPERM Cryo-preserved spermatozoa $546.25 / $882.81
Non-Profit / For-Profit
Aliquot Approximate quantity3
067994-UCD-RESUS Litter recovered from cryo-archive $4,044.00 / $7,650.23
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.