Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8464Btlr/Mmmh
Stock Number:
067908-MU
Citation ID:
RRID:MMRRC_067908-MU
Other Names:
R8464 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Erbb4
Name: erb-b2 receptor tyrosine kinase 4
Synonyms: ErbB4, Her4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13869
HGNC: HGNC:3432
Homologene: 21084
Ttc27
Name: tetratricopeptide repeat domain 27
Synonyms: 2610511O17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74196
VEGA: 17
Homologene: 41191
Kif5b
Name: kinesin family member 5B
Synonyms: Khc, kinesin heavy chain
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16573
HGNC: HGNC:6324
Homologene: 55829
Mms19
Name: MMS19 cytosolic iron-sulfur assembly component
Synonyms: 2610042O15Rik, Mms19, C86341, Mms19l
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72199
Homologene: 41480
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Taf6
Name: TATA-box binding protein associated factor 6
Synonyms: p80, Taf2e, 80kDa
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21343
Homologene: 7561
Ctla4
Name: cytotoxic T-lymphocyte-associated protein 4
Synonyms: Ctla-4, Ly-56, Cd152
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12477
HGNC: HGNC:2505
Homologene: 3820
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Chst14
Name: carbohydrate sulfotransferase 14
Synonyms: 2600016L03Rik, D4st1, D4ST-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72136
Homologene: 12443
Fam151a
Name: family with sequence simliarity 151, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230579
Homologene: 17143
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Pomgnt1
Name: protein O-linked mannose beta 1,2-N-acetylglucosaminyltransferase
Synonyms: 0610016I07Rik, 4930467B06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68273
Homologene: 9806
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Osgepl1
Name: O-sialoglycoprotein endopeptidase-like 1
Synonyms: MGC13061, 2610001M19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72085
Homologene: 5561
Myo1a
Name: myosin IA
Synonyms: BBM-I, brush border myosin 1, Myhl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Ccdc13
Name: coiled-coil domain containing 13
Synonyms: 2900041A11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100502861
Homologene: 87213
Mypn
Name: myopalladin
Synonyms: 1110056A04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68802
VEGA: 10
Homologene: 23778
Or6c212
Name: olfactory receptor family 6 subfamily C member 212
Synonyms: GA_x6K02T2PULF-11402237-11401278, MOR110-4, Olfr805
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258548
Pacsin2
Name: protein kinase C and casein kinase substrate in neurons 2
Synonyms: Syndapin II
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 23970
VEGA: 15
HGNC: HGNC:8571
Homologene: 21414
Lipo2
Name: lipase, member O2
Synonyms: Gm8981
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 101055671
Homologene: 103863
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Synonyms: CEFIP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Spag6l
Name: sperm associated antigen 6-like
Synonyms: PF16, Spag6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50525
Homologene: 8252
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Selenov
Name: selenoprotein V
Synonyms: BC089491
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 280621
Homologene: 35357
Itga3
Name: integrin alpha 3
Synonyms: VLA-3 alpha 3, alpha3-integrin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16400
HGNC: HGNC:6139
Homologene: 21129
Sdhd
Name: succinate dehydrogenase complex, subunit D, integral membrane protein
Synonyms: 3110001M13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66925
VEGA: 9
Homologene: 37718
Or4k40
Name: olfactory receptor family 4 subfamily K member 40
Synonyms: GA_x6K02T2Q125-72472405-72471488, MOR248-21, Olfr1286
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277562
Homologene: 73992
Or4b1d
Name: olfactory receptor family 4 subfamily B member 1D
Synonyms: MTPCR05, MOR227-7P, GA_x6K02T2Q125-51573576-51572650, MOR227-9_p, Olfr32
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18331
HGNC: HGNC:8290
Homologene: 110550
Foxa1
Name: forkhead box A1
Synonyms: Tcf-3a, Hnf-3a, Tcf3a, Hnf3a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15375
VEGA: 12
HGNC: HGNC:5021
Homologene: 3307
4933402J07Rik
Name: RIKEN cDNA 4933402J07 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330820
Homologene: 51633
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 53,318,140 bp
  • A to G, chromosome 1 at 60,912,527 bp
  • A to G, chromosome 1 at 66,473,264 bp
  • T to C, chromosome 1 at 68,309,626 bp
  • T to C, chromosome 2 at 66,566,281 bp
  • G to T, chromosome 2 at 90,138,603 bp
  • A to G, chromosome 2 at 111,420,847 bp
  • T to C, chromosome 2 at 118,927,043 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • T to C, chromosome 4 at 8,811,465 bp
  • T to A, chromosome 4 at 106,747,905 bp
  • T to C, chromosome 4 at 116,152,151 bp
  • T to C, chromosome 5 at 138,182,662 bp
  • C to T, chromosome 7 at 28,288,472 bp
  • G to A, chromosome 8 at 85,094,143 bp
  • C to A, chromosome 8 at 87,589,021 bp
  • T to C, chromosome 9 at 37,421,430 bp
  • T to C, chromosome 9 at 50,597,131 bp
  • T to C, chromosome 9 at 107,512,007 bp
  • T to C, chromosome 9 at 121,820,758 bp
  • T to A, chromosome 10 at 63,131,198 bp
  • G to T, chromosome 10 at 127,718,584 bp
  • A to T, chromosome 10 at 129,722,914 bp
  • T to A, chromosome 11 at 77,454,253 bp
  • C to A, chromosome 11 at 95,062,740 bp
  • T to C, chromosome 11 at 100,757,184 bp
  • T to C, chromosome 11 at 107,131,342 bp
  • T to C, chromosome 12 at 3,899,635 bp
  • C to A, chromosome 12 at 57,542,460 bp
  • C to T, chromosome 12 at 75,965,772 bp
  • C to T, chromosome 12 at 115,067,689 bp
  • T to A, chromosome 14 at 26,953,028 bp
  • T to C, chromosome 14 at 32,659,977 bp
  • A to T, chromosome 15 at 83,379,183 bp
  • T to C, chromosome 16 at 16,763,034 bp
  • T to G, chromosome 17 at 35,622,206 bp
  • A to G, chromosome 17 at 74,717,930 bp
  • A to T, chromosome 18 at 6,225,381 bp
  • A to T, chromosome 18 at 31,962,704 bp
  • C to T, chromosome 19 at 33,748,623 bp
  • A to C, chromosome 19 at 41,947,083 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8464 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067908-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.