Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8432Btlr/Mmmh
Stock Number:
067882-MU
Citation ID:
RRID:MMRRC_067882-MU
Other Names:
R8432 (G1)
Major Collection:

Strain Information

Agpat5
Name: 1-acylglycerol-3-phosphate O-acyltransferase 5
Synonyms: 1110013A05Rik, D8Ertd319e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52123
Homologene: 10153
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Cpne3
Name: copine III
Synonyms: PRO1071, CPN3, 5730450C07Rik, 5430428M23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70568
HGNC: HGNC:2316
Homologene: 20839
Taf15
Name: TATA-box binding protein associated factor 15
Synonyms: TAFII68, 2610111C21Rik, Taf2n, 68kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70439
Homologene: 131088
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Taf12
Name: TATA-box binding protein associated factor 12
Synonyms: Taf2J, 2810422D08Rik, 20kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66464
Homologene: 68477
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Abhd5
Name: abhydrolase domain containing 5
Synonyms: NCIE2, IECN5, 1300003D03Rik, 2010002J10Rik, CGI-58
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67469
Homologene: 41088
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Zfp931
Name: zinc finger protein 931
Synonyms: 2810021G02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 353208
Homologene: 136272
Prkag1
Name: protein kinase, AMP-activated, gamma 1 non-catalytic subunit
Synonyms: Prkaac
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19082
VEGA: 15
HGNC: HGNC:9385
Homologene: 99712
Riok1
Name: RIO kinase 1
Synonyms: 5430416A05Rik, 3110046C13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71340
VEGA: 13
Homologene: 6950
Rbm19
Name: RNA binding motif protein 19
Synonyms: 1200009A02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74111
Homologene: 7158
Gzf1
Name: GDNF-inducible zinc finger protein 1
Synonyms: 8430437G08Rik, Zfp336
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74533
Homologene: 11200
Rap1gds1
Name: RAP1, GTP-GDP dissociation stimulator 1
Synonyms: GDS1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229877
HGNC: HGNC:9859
Homologene: 41422
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Smpd3
Name: sphingomyelin phosphodiesterase 3, neutral
Synonyms: neutral sphingomyelinase II, nSMase2, 4631433G07Rik, fro, Nsm2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 58994
Homologene: 10260
Bhlhe40
Name: basic helix-loop-helix family, member e40
Synonyms: eip1 (E47 interaction protein 1), Stra13, CR8, cytokine response gene 8, Clast5, C130042M06Rik, Stra14, DEC1, Sharp2, Bhlhb2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20893
HGNC: HGNC:1046
Homologene: 2722
Gp2
Name: glycoprotein 2 zymogen granule membrane
Synonyms: 2310037I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67133
HGNC: HGNC:4441
Homologene: 133790
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Cubn
Name: cubilin
Synonyms: D2Wsu88e, intrinsic factor-cobalamin receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Ercc5
Name: excision repair cross-complementing rodent repair deficiency, complementation group 5
Synonyms: Xpg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22592
HGNC: HGNC:3437
Homologene: 133551
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Gckr
Name: glucokinase regulatory protein
Synonyms: GKRP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231103
HGNC: HGNC:4196
Homologene: 1139
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Cdh5
Name: cadherin 5
Synonyms: VE-cadherin, 7B4/cadherin-5, VEC, CD144, VE-Cad, VECD, VEcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12562
HGNC: HGNC:1764
Homologene: 1359
Atxn7
Name: ataxin 7
Synonyms: ataxin-7, Sca7, A430107N12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 246103
VEGA: 14
Homologene: 30967
Ap4b1
Name: adaptor-related protein complex AP-4, beta 1
Synonyms: AP-4 beta-4, 1810038H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67489
HGNC: HGNC:572
Homologene: 38203
Efna5
Name: ephrin A5
Synonyms: AL-1, RAGS, Ephrin-A5, Epl7, EFL-5, LERK-7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13640
HGNC: HGNC:3225
Homologene: 1482
Pgm2l1
Name: phosphoglucomutase 2-like 1
Synonyms: BM32A, 4931406N15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70974
Homologene: 12374
Psma1
Name: proteasome subunit alpha 1
Synonyms: C2, Pros-30, HC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26440
HGNC: HGNC:9530
Homologene: 2080
Zbtb38
Name: zinc finger and BTB domain containing 38
Synonyms: A930014K01Rik, Zenon homolog, CIBZ
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245007
Homologene: 19529
Trim67
Name: tripartite motif-containing 67
Synonyms: D130049O21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330863
Homologene: 45699
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Gid8
Name: GID complex subunit 8
Synonyms: 2310003C23Rik, 4833420G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76425
Homologene: 41207
Nepn
Name: nephrocan
Synonyms: 5730521E12Rik, Npn, periolin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66650
Homologene: 23549
AY358078
Name: cDNA sequence AY358078
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 278676
Homologene: 115686
Ttc24
Name: tetratricopeptide repeat domain 24
Synonyms: A430025D11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214191
Homologene: 82282
Tmem168
Name: transmembrane protein 168
Synonyms: 5730526F17Rik, 8430437G11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101118
Homologene: 11202
Arhgef40
Name: Rho guanine nucleotide exchange factor 40
Synonyms: E130112L23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268739
Homologene: 19560
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Ecd
Name: ecdysoneless cell cycle regulator
Synonyms: 5730461K03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70601
VEGA: 14
Homologene: 5256
Otulinl
Name: OTU deubiquitinase with linear linkage specificity like
Synonyms: Fam105a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223433
VEGA: 15
Homologene: 41302
Or8b40
Name: olfactory receptor family 8 subfamily B member 40
Synonyms: GA_x6K02T2PVTD-31795028-31795957, MOR162-2, Olfr889
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258475
Homologene: 138311
Mlip
Name: muscular LMNA-interacting protein
Synonyms: 2310046A06Rik, CIP, cardiac ISL1-interacting protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69642
Homologene: 90445
Dhrs7
Name: dehydrogenase/reductase 7
Synonyms: retDSR4, retSDR4, 2310016E22Rik, 5730564L20Rik, dehydrogenase/reductase (SDR family) member 7
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66375
VEGA: 12
Homologene: 9350
Tc2n
Name: tandem C2 domains, nuclear
Synonyms: 4933406D09Rik, Tac2-N, Mtac2d1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74413
Homologene: 12560
Mrpl19
Name: mitochondrial ribosomal protein L19
Synonyms: MRP-L15, D6Ertd157e, Rpml15, RLX1, 9030416F12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56284
Homologene: 8851
Taar3
Name: trace amine-associated receptor 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 493809
HGNC: HGNC:4513
Homologene: 117490
Or52e8
Name: olfactory receptor family 52 subfamily E member 8
Synonyms: GA_x6K02T2PBJ9-7604826-7603885, MOR32-12, Olfr671
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257910
Homologene: 133595
Erich4
Name: glutamate rich 4
Synonyms: Gm7092
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 632778
Homologene: 86877
Cacng2
Name: calcium channel, voltage-dependent, gamma subunit 2
Synonyms: stargazin, B230105C07Rik, B930041E13Rik, TARP gamma 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12300
HGNC: HGNC:1406
Homologene: 4432
Tspan1
Name: tetraspanin 1
Synonyms: 9030418M05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66805
Homologene: 21170
Bnip5
Name: BCL2 interacting protein 5
Synonyms: 4930539E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 207819
Homologene: 52098
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 44,167,681 bp
  • G to C, chromosome 1 at 53,618,036 bp
  • C to T, chromosome 1 at 74,928,044 bp
  • T to A, chromosome 2 at 13,381,799 bp
  • A to T, chromosome 2 at 67,510,618 bp
  • C to T, chromosome 2 at 76,863,556 bp
  • G to T, chromosome 2 at 120,038,596 bp
  • A to G, chromosome 2 at 148,690,195 bp
  • A to G, chromosome 2 at 178,069,553 bp
  • A to G, chromosome 2 at 180,714,861 bp
  • G to A, chromosome 3 at 88,070,059 bp
  • G to A, chromosome 3 at 103,820,819 bp
  • T to C, chromosome 3 at 138,941,787 bp
  • A to T, chromosome 4 at 19,535,227 bp
  • G to T, chromosome 4 at 116,163,954 bp
  • A to G, chromosome 4 at 132,291,917 bp
  • A to T, chromosome 5 at 31,309,103 bp
  • A to G, chromosome 5 at 112,764,512 bp
  • T to G, chromosome 5 at 120,175,926 bp
  • A to G, chromosome 6 at 13,602,536 bp
  • A to G, chromosome 6 at 81,962,155 bp
  • TG to TGG, chromosome 6 at 108,664,857 bp
  • A to G, chromosome 7 at 25,615,108 bp
  • A to G, chromosome 7 at 56,155,112 bp
  • A to C, chromosome 7 at 77,124,686 bp
  • A to G, chromosome 7 at 100,260,053 bp
  • T to G, chromosome 7 at 104,975,992 bp
  • A to T, chromosome 7 at 114,273,845 bp
  • C to T, chromosome 7 at 119,442,787 bp
  • A to T, chromosome 8 at 18,846,761 bp
  • A to C, chromosome 8 at 33,576,544 bp
  • A to T, chromosome 8 at 104,113,066 bp
  • T to A, chromosome 8 at 106,257,677 bp
  • A to T, chromosome 8 at 110,597,951 bp
  • TGCCGCCGCCGCCGC to TGCCGCCGCCGC, chromosome 8 at 124,794,062 bp
  • A to G, chromosome 9 at 38,115,976 bp
  • G to A, chromosome 9 at 59,780,265 bp
  • A to T, chromosome 9 at 77,190,729 bp
  • A to C, chromosome 9 at 96,686,238 bp
  • A to G, chromosome 9 at 122,368,252 bp
  • A to T, chromosome 10 at 23,950,155 bp
  • A to T, chromosome 10 at 52,391,784 bp
  • G to A, chromosome 10 at 76,420,205 bp
  • AGAAGTGGAGGCTACGGTGGAGACCGAAGTGG to AGAAGTGG, chromosome 11 at 83,505,025 bp
  • G to A, chromosome 12 at 72,664,807 bp
  • A to T, chromosome 12 at 101,649,104 bp
  • A to T, chromosome 12 at 110,618,142 bp
  • T to C, chromosome 13 at 38,037,492 bp
  • T to G, chromosome 13 at 55,247,703 bp
  • T to C, chromosome 13 at 97,951,583 bp
  • T to C, chromosome 14 at 14,013,635 bp
  • T to A, chromosome 14 at 20,320,930 bp
  • T to A, chromosome 14 at 51,822,178 bp
  • T to A, chromosome 14 at 51,989,400 bp
  • A to T, chromosome 15 at 27,664,732 bp
  • A to G, chromosome 15 at 78,013,322 bp
  • T to G, chromosome 15 at 85,817,293 bp
  • T to C, chromosome 15 at 98,815,544 bp
  • C to T, chromosome 17 at 28,899,571 bp
  • A to T, chromosome 17 at 42,798,593 bp
  • A to G, chromosome 17 at 62,651,022 bp
  • A to T, chromosome 17 at 78,803,501 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8432 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067882-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.