Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8424Btlr/Mmmh
Stock Number:
067818-MU
Citation ID:
RRID:MMRRC_067818-MU
Other Names:
R8424 (G1)
Major Collection:

Strain Information

Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: roquin, 5730557L09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381305
Homologene: 19036
Pmp22
Name: peripheral myelin protein 22
Synonyms: Gas-3, TRE002
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18858
HGNC: HGNC:9118
Homologene: 7482
Spry2
Name: sprouty RTK signaling antagonist 2
Synonyms: sprouty2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 24064
VEGA: 14
Homologene: 4267
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Ube2h
Name: ubiquitin-conjugating enzyme E2H
Synonyms: E2-20K, 1500009C23Rik, Ubc8, Gid3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22214
Homologene: 103894
Tnpo3
Name: transportin 3
Synonyms: 5730544L10Rik, C430013M08Rik, D6Ertd313e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320938
Homologene: 40848
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Ncbp1
Name: nuclear cap binding protein subunit 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433702
HGNC: HGNC:7658
Homologene: 1859
Cbl
Name: Casitas B-lineage lymphoma
Synonyms: Cbl-2, c-Cbl, 4732447J05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12402
HGNC: HGNC:1541
Homologene: 3802
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Alx4
Name: aristaless-like homeobox 4
Synonyms: Aristaless-like 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11695
HGNC: HGNC:450
Homologene: 7229
Csrp1
Name: cysteine and glycine-rich protein 1
Synonyms: CRP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13007
HGNC: HGNC:2469
Homologene: 37874
Adar
Name: adenosine deaminase, RNA-specific
Synonyms: ADAR1, mZaADAR, Adar1p150, Adar1p110
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56417
HGNC: HGNC:225
Homologene: 9281
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Nadk2
Name: NAD kinase 2, mitochondrial
Synonyms: 4933430B08Rik, 1110020G09Rik, Nadkd1, MNADK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68646
Homologene: 14638
Scd2
Name: stearoyl-Coenzyme A desaturase 2
Synonyms: Scd-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20250
VEGA: 19
Homologene: 136612
Cdh5
Name: cadherin 5
Synonyms: VE-cadherin, 7B4/cadherin-5, VEC, CD144, VE-Cad, VECD, VEcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12562
HGNC: HGNC:1764
Homologene: 1359
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Zfp352
Name: zinc finger protein 352
Synonyms: 2czf48
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236537
Homologene: 45160
Klhl5
Name: kelch-like 5
Synonyms: 1300013C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71778
HGNC: HGNC:6356
Homologene: 56736
Serpina1c
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1C
Synonyms: PI6, PI3, Spi1-3, Spi1-6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20702
HGNC: HGNC:8941
Homologene: 20103
Fam83a
Name: family with sequence similarity 83, member A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239463
Homologene: 13158
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Bag6
Name: BCL2-associated athanogene 6
Synonyms: D17H6S52E, G3, 2410045D21Rik, Scythe, Bat3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224727
Homologene: 3409
Wfdc8
Name: WAP four-disulfide core domain 8
Synonyms: LOC277343
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277343
Homologene: 33799
Sting1
Name: stimulator of interferon response cGAMP interactor 1
Synonyms: 2610307O08Rik, MPYS, ERIS, Sting, Tmem173
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72512
VEGA: 18
Homologene: 18868
Tiam2
Name: T cell lymphoma invasion and metastasis 2
Synonyms: STEF, 3000002F19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 24001
VEGA: 17
Homologene: 40796
Abhd2
Name: abhydrolase domain containing 2
Synonyms: 2210009N18Rik, LABH2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54608
Homologene: 23121
Dgki
Name: diacylglycerol kinase, iota
Synonyms: C130010K08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320127
HGNC: HGNC:2855
Homologene: 37956
Zfp952
Name: zinc finger protein 952
Synonyms: C920016K16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240067
Homologene: 128790
Vmn1r203
Name: vomeronasal 1 receptor 203
Synonyms: V1rh11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171270
Homologene: 110880
Cd300ld2
Name: CD300 molecule like family member D2
Synonyms: Gm11709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629970
Cutal
Name: cutA divalent cation tolerance homolog-like
Synonyms: D730039F16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77996
Homologene: 66286
Or5ac21
Name: olfactory receptor family 5 subfamily AC member 21
Synonyms: GA_x54KRFPKG5P-55517445-55518365, MOR182-5, Olfr203
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258479
Homologene: 122781
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Cdk5rap1
Name: CDK5 regulatory subunit associated protein 1
Synonyms: 2310066P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66971
Homologene: 9502
Acss2
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, ACAS, AceCS1, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Keap1
Name: kelch-like ECH-associated protein 1
Synonyms: ring canal protein, INrf2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50868
Homologene: 8184
S100a7a
Name: S100 calcium binding protein A7A
Synonyms: S100A7f, LOC381493, S100a17l1, S100a15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381493
Homologene: 82417
Tas2r130
Name: taste receptor, type 2, member 130
Synonyms: Tas2r30, STC 7-4, mt2r42, T2R30
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387355
Homologene: 41536
Sh3yl1
Name: Sh3 domain YSC-like 1
Synonyms: YSC84, Ray
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 24057
Homologene: 31662
Lbhd1
Name: LBH domain containing 1
Synonyms: Gm21743
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 102308570
Homologene: 75203
H2ac4
Name: H2A clustered histone 4
Synonyms: H2a-53, H2A.1, Hist1h2ab
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319172
Homologene: 137350
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 135,739,450 bp
  • C to T, chromosome 1 at 160,965,772 bp
  • T to C, chromosome 2 at 34,887,792 bp
  • A to G, chromosome 2 at 93,677,469 bp
  • T to C, chromosome 2 at 112,841,894 bp
  • T to C, chromosome 2 at 154,346,012 bp
  • A to G, chromosome 2 at 155,574,618 bp
  • A to G, chromosome 2 at 164,603,158 bp
  • C to T, chromosome 3 at 89,735,994 bp
  • A to T, chromosome 3 at 90,021,031 bp
  • T to A, chromosome 3 at 90,655,561 bp
  • A to T, chromosome 4 at 46,144,839 bp
  • C to T, chromosome 4 at 90,224,243 bp
  • A to C, chromosome 5 at 65,162,962 bp
  • C to T, chromosome 5 at 76,594,059 bp
  • A to T, chromosome 5 at 110,693,278 bp
  • G to A, chromosome 5 at 111,233,341 bp
  • A to G, chromosome 6 at 29,555,206 bp
  • A to G, chromosome 6 at 30,260,941 bp
  • C to A, chromosome 6 at 36,850,915 bp
  • A to G, chromosome 6 at 113,149,683 bp
  • T to C, chromosome 6 at 118,388,760 bp
  • T to C, chromosome 6 at 119,934,427 bp
  • T to G, chromosome 6 at 131,630,827 bp
  • C to T, chromosome 7 at 79,297,137 bp
  • T to C, chromosome 7 at 127,542,388 bp
  • G to T, chromosome 8 at 22,772,232 bp
  • G to A, chromosome 8 at 104,129,371 bp
  • G to T, chromosome 8 at 108,856,753 bp
  • T to C, chromosome 9 at 20,918,540 bp
  • C to A, chromosome 9 at 21,230,790 bp
  • G to A, chromosome 9 at 44,152,854 bp
  • G to T, chromosome 11 at 63,133,076 bp
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp
  • G to A, chromosome 12 at 30,924,863 bp
  • T to C, chromosome 12 at 103,896,037 bp
  • T to C, chromosome 13 at 22,524,834 bp
  • A to G, chromosome 13 at 23,751,284 bp
  • A to G, chromosome 13 at 67,822,352 bp
  • A to G, chromosome 14 at 105,893,402 bp
  • T to C, chromosome 15 at 9,083,334 bp
  • T to A, chromosome 15 at 58,009,650 bp
  • A to T, chromosome 16 at 59,303,409 bp
  • T to A, chromosome 17 at 3,516,041 bp
  • T to C, chromosome 17 at 3,516,042 bp
  • T to A, chromosome 17 at 33,003,217 bp
  • T to A, chromosome 17 at 35,146,854 bp
  • C to A, chromosome 17 at 45,415,600 bp
  • A to C, chromosome 18 at 35,739,170 bp
  • T to A, chromosome 19 at 8,883,977 bp
  • G to T, chromosome 19 at 44,301,304 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8424 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067818-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.