Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8233Btlr/Mmmh
Stock Number:
067665-MU
Citation ID:
RRID:MMRRC_067665-MU
Other Names:
R8233 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Tyrp1
Name: tyrosinase-related protein 1
Synonyms: Tyrp, isa, TRP-1, TRP1, Oca3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22178
Homologene: 464
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Crot
Name: carnitine O-octanoyltransferase
Synonyms: 1200003H03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74114
HGNC: HGNC:2366
Homologene: 10899
Magoh
Name: mago homolog, exon junction complex core component
Synonyms: Mago-m, Mos2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17149
HGNC: HGNC:6815
Homologene: 1776
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Rxrb
Name: retinoid X receptor beta
Synonyms: RCoR-1, H-2RIIBP, Nr2b2, Rub
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20182
Homologene: 7923
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Igfbp3
Name: insulin-like growth factor binding protein 3
Synonyms: IGFBP-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16009
HGNC: HGNC:5472
Homologene: 500
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Degs1
Name: delta 4-desaturase, sphingolipid 1
Synonyms: Mdes, Des1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13244
Homologene: 55770
Hnrnpa3
Name: heterogeneous nuclear ribonucleoprotein A3
Synonyms: 2410013L13Rik, 2610209F03Rik, 2610510D13Rik, Hnrpa3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229279
Homologene: 138303
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Krt14
Name: keratin 14
Synonyms: epidermolysis bullosa simplex, Dowling-Meara, Koebner, Krt-1.14, K14, Cytokeratin 14, Krt1-14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16664
HGNC: HGNC:6416
Homologene: 110439
Pdcd1
Name: programmed cell death 1
Synonyms: PD-1, Pdc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18566
HGNC: HGNC:8760
Homologene: 3681
Tnik
Name: TRAF2 and NCK interacting kinase
Synonyms: 4831440I19Rik, 1500031A17Rik, C530008O15Rik, C630040K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 665113
Homologene: 77943
Lrrc74b
Name: leucine rich repeat containing 74B
Synonyms: 4930451C15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74685
Homologene: 25894
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57775
Homologene: 49641
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Ptprn
Name: protein tyrosine phosphatase receptor type N
Synonyms: IA-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19275
HGNC: HGNC:9676
Homologene: 48142
Srgap1
Name: SLIT-ROBO Rho GTPase activating protein 1
Synonyms: 4930572H05Rik, Arhgap13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117600
Homologene: 56898
Cd101
Name: CD101 antigen
Synonyms: LOC381460, Igsf2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 630146
HGNC: HGNC:5949
Homologene: 3142
Dgkz
Name: diacylglycerol kinase zeta
Synonyms: mDGK[z], E130307B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104418
HGNC: HGNC:2857
Homologene: 37831
4930503L19Rik
Name: RIKEN cDNA 4930503L19 gene
Synonyms: Las2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269033
Homologene: 52120
Col6a2
Name: collagen, type VI, alpha 2
Synonyms: Col6a-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12834
HGNC: HGNC:2212
Homologene: 1392
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
H2-Q10
Name: histocompatibility 2, Q region locus 10
Synonyms: H-2Q10, Qa10, Q10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15007
Homologene: 128352
Usp45
Name: ubiquitin specific petidase 45
Synonyms: 3110003C05Rik, Gcap7, 4930550B20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77593
Homologene: 17674
Or13a27
Name: olfactory receptor family 13 subfamily A member 27
Synonyms: IH6, MOR253-6, GA_x6K02T2PBJ9-42496183-42495251, Olfr60
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18361
Homologene: 34961
Plcxd3
Name: phosphatidylinositol-specific phospholipase C, X domain containing 3
Synonyms: B130016O10Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239318
Homologene: 45574
Vmn1r119
Name: vomeronasal 1 receptor 119
Synonyms: LOC384696, Gm1447
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384696
Homologene: 104166
Polr2m
Name: polymerase (RNA) II (DNA directed) polypeptide M
Synonyms: D9Wsu138e, Grinl1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 28015
Homologene: 9181
Gm13762
Name: predicted gene 13762
Type: Gene
Species: Mouse
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 71,351,757 bp
  • A to T, chromosome 1 at 75,253,152 bp
  • A to G, chromosome 1 at 94,039,417 bp
  • A to T, chromosome 1 at 118,844,437 bp
  • T to C, chromosome 1 at 135,968,044 bp
  • T to A, chromosome 1 at 139,457,304 bp
  • A to G, chromosome 1 at 182,279,595 bp
  • A to G, chromosome 2 at 75,662,516 bp
  • C to T, chromosome 2 at 88,973,738 bp
  • A to G, chromosome 2 at 91,939,649 bp
  • T to C, chromosome 2 at 178,356,634 bp
  • T to A, chromosome 3 at 28,554,937 bp
  • A to T, chromosome 3 at 60,625,130 bp
  • G to T, chromosome 3 at 100,993,673 bp
  • T to C, chromosome 4 at 21,781,736 bp
  • T to C, chromosome 4 at 72,124,944 bp
  • T to C, chromosome 4 at 80,850,953 bp
  • C to T, chromosome 4 at 88,850,391 bp
  • T to G, chromosome 4 at 107,880,935 bp
  • A to T, chromosome 5 at 8,976,027 bp
  • A to T, chromosome 5 at 36,615,244 bp
  • C to CTCA, chromosome 6 at 4,756,453 bp
  • A to T, chromosome 6 at 113,765,719 bp
  • T to A, chromosome 7 at 6,962,407 bp
  • A to G, chromosome 7 at 21,012,007 bp
  • T to G, chromosome 7 at 140,345,498 bp
  • T to A, chromosome 8 at 44,952,018 bp
  • T to A, chromosome 9 at 71,483,584 bp
  • A to G, chromosome 10 at 76,608,706 bp
  • A to G, chromosome 10 at 121,825,436 bp
  • T to A, chromosome 11 at 7,210,152 bp
  • A to G, chromosome 11 at 83,187,529 bp
  • A to G, chromosome 11 at 100,203,352 bp
  • A to G, chromosome 14 at 66,357,892 bp
  • A to G, chromosome 15 at 4,516,835 bp
  • A to C, chromosome 15 at 94,291,652 bp
  • T to A, chromosome 16 at 17,558,225 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to G, chromosome 17 at 34,036,905 bp
  • A to G, chromosome 17 at 35,471,086 bp
  • A to T, chromosome 18 at 70,469,616 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8233 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067665-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.