Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8151Btlr/Mmmh
Stock Number:
067577-MU
Citation ID:
RRID:MMRRC_067577-MU
Other Names:
R8151 (G1)
Major Collection:

Strain Information

Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Polr2d
Name: polymerase (RNA) II (DNA directed) polypeptide D
Synonyms: 2310002G05Rik, HSRBP4, RBP4, 2610028L19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69241
VEGA: 18
HGNC: HGNC:9191
Homologene: 37968
Stx16
Name: syntaxin 16
Synonyms: 5430410K23Rik, SYN16, 6330500A18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228960
Homologene: 2791
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Kras
Name: Kirsten rat sarcoma viral oncogene homolog
Synonyms: Ki-ras, Kras-2, K-ras, Kras2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16653
HGNC: HGNC:6407
Homologene: 37990
Rasal2
Name: RAS protein activator like 2
Synonyms: A330066M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226525
HGNC: HGNC:9874
Homologene: 35217
Nup85
Name: nucleoporin 85
Synonyms: frount, Pcnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 445007
HGNC: HGNC:8734
Homologene: 11755
St6galnac3
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3
Synonyms: ST6GalNAc III, Siat7c
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20447
Homologene: 7938
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Cenpe
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Sorl1
Name: sortilin-related receptor, LDLR class A repeats-containing
Synonyms: LR11, mSorLA, 2900010L19Rik, Sorla
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20660
Homologene: 2336
Nudcd2
Name: NudC domain containing 2
Synonyms: 2700047N05Rik, D11Ertd603e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52653
Homologene: 12094
Plvap
Name: plasmalemma vesicle associated protein
Synonyms: PV-1, MECA32
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 84094
Homologene: 10578
Btbd16
Name: BTB domain containing 16
Synonyms: E330040A16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330660
Homologene: 77327
Ldlrad4
Name: low density lipoprotein receptor class A domain containing 4
Synonyms: D330030L18Rik, A430108L08Rik, 8230401C20Rik, D18Ertd653e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52662
VEGA: 18
HGNC: HGNC:1224
Homologene: 3202
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: 9930021J17Rik, Fam160a1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Txnip
Name: thioredoxin interacting protein
Synonyms: THIF, VDUP1, mVDUP1, Hyplip1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56338
Homologene: 38186
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: Arhgap14, D130026O08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259302
Homologene: 56686
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212392
Homologene: 17668
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Odad2
Name: outer dynein arm docking complex subunit 2
Synonyms: 4930463I21Rik, Armc4, b2b227.1Clo, b2b643Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74934
VEGA: 18
Homologene: 9992
Ptprt
Name: protein tyrosine phosphatase receptor type T
Synonyms: RPTPrho
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19281
HGNC: HGNC:9682
Homologene: 56924
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17836
HGNC: HGNC:9750
Homologene: 136663
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Lhcgr
Name: luteinizing hormone/choriogonadotropin receptor
Synonyms: Lhr, Gpcr19-rs1, LH-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16867
VEGA: 17
HGNC: HGNC:6585
Homologene: 37276
Aldh8a1
Name: aldehyde dehydrogenase 8 family, member A1
Synonyms: RALDH4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237320
Homologene: 23369
Zfp217
Name: zinc finger protein 217
Synonyms: 4933431C08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228913
Homologene: 4757
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Klk1b21
Name: kallikrein 1-related peptidase b21
Synonyms: mGk-21, Klk21
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16616
Homologene: 68141
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Fbxo39
Name: F-box protein 39
Synonyms: 1700010H23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 628100
Homologene: 15156
Ifi202b
Name: interferon activated gene 202B
Synonyms: p202
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26388
Ctif
Name: CBP80/20-dependent translation initiation factor
Synonyms: LOC269037, Gm672
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269037
VEGA: 18
Homologene: 56682
Vcam1
Name: vascular cell adhesion molecule 1
Synonyms: CD106, Vcam-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22329
Homologene: 838
Vav3
Name: vav 3 oncogene
Synonyms: A530094I06Rik, Idd18.1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Polm
Name: polymerase (DNA directed), mu
Synonyms: Tdt-N, B230309I03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54125
HGNC: HGNC:9185
Homologene: 41170
Plppr2
Name: phospholipid phosphatase related 2
Synonyms: PRG-4, BC018242, Lppr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235044
Homologene: 11229
Aipl1
Name: aryl hydrocarbon receptor-interacting protein-like 1
Synonyms: A930007I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114230
HGNC: HGNC:359
Homologene: 22806
Havcr2
Name: hepatitis A virus cellular receptor 2
Synonyms: Tim3, Timd3, TIM-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171285
Homologene: 129541
Vta1
Name: vesicle (multivesicular body) trafficking 1
Synonyms: 1110001D18Rik, 1110059P08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66201
Homologene: 6473
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 40,525,268 bp
  • C to A, chromosome 1 at 157,243,584 bp
  • T to C, chromosome 1 at 173,977,357 bp
  • T to C, chromosome 2 at 162,278,085 bp
  • G to A, chromosome 2 at 170,119,651 bp
  • T to A, chromosome 2 at 174,093,491 bp
  • G to A, chromosome 3 at 38,892,054 bp
  • A to T, chromosome 3 at 85,688,540 bp
  • A to G, chromosome 3 at 96,559,613 bp
  • A to C, chromosome 3 at 109,508,848 bp
  • A to C, chromosome 3 at 116,124,479 bp
  • A to G, chromosome 3 at 135,247,022 bp
  • C to T, chromosome 3 at 153,411,580 bp
  • T to C, chromosome 4 at 123,397,413 bp
  • T to C, chromosome 4 at 139,402,801 bp
  • G to A, chromosome 6 at 48,029,141 bp
  • A to C, chromosome 6 at 112,816,667 bp
  • T to C, chromosome 6 at 121,841,158 bp
  • ACTTCTTCTTCTTCTTCTTC to ACTTCTTCTTCTTCTTC, chromosome 6 at 145,220,634 bp
  • T to C, chromosome 7 at 28,153,341 bp
  • C to T, chromosome 7 at 44,104,363 bp
  • T to A, chromosome 7 at 126,414,306 bp
  • T to C, chromosome 7 at 130,797,095 bp
  • G to A, chromosome 8 at 45,942,793 bp
  • A to G, chromosome 8 at 71,507,981 bp
  • A to G, chromosome 9 at 21,940,809 bp
  • A to G, chromosome 9 at 42,067,933 bp
  • A to G, chromosome 9 at 66,433,791 bp
  • A to T, chromosome 9 at 79,630,549 bp
  • C to A, chromosome 10 at 14,667,953 bp
  • C to T, chromosome 10 at 21,395,566 bp
  • T to C, chromosome 10 at 77,112,584 bp
  • T to C, chromosome 11 at 5,837,906 bp
  • A to T, chromosome 11 at 40,733,702 bp
  • A to G, chromosome 11 at 46,475,895 bp
  • C to A, chromosome 11 at 72,036,758 bp
  • G to A, chromosome 11 at 72,317,700 bp
  • T to C, chromosome 11 at 102,206,468 bp
  • A to G, chromosome 11 at 113,872,857 bp
  • A to G, chromosome 11 at 115,577,933 bp
  • A to G, chromosome 15 at 9,601,512 bp
  • AT to ATT, chromosome 17 at 88,742,249 bp
  • A to G, chromosome 18 at 7,127,358 bp
  • T to A, chromosome 18 at 31,795,312 bp
  • A to G, chromosome 18 at 68,250,572 bp
  • G to T, chromosome 18 at 75,520,105 bp
  • T to C, chromosome 19 at 9,004,679 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8151 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067577-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.