Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8037Btlr/Mmmh
Stock Number:
067474-MU
Citation ID:
RRID:MMRRC_067474-MU
Other Names:
R8037 (G1)
Major Collection:

Strain Information

Dbh
Name: dopamine beta hydroxylase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13166
HGNC: HGNC:2689
Homologene: 615
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Fam110b
Name: family with sequence similarity 110, member B
Synonyms: 1700012H17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242297
Homologene: 17518
Senp2
Name: SUMO/sentrin specific peptidase 2
Synonyms: 4930538C18Rik, 2310007L05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75826
VEGA: 16
Homologene: 11005
Dhdds
Name: dehydrodolichyl diphosphate synthase
Synonyms: 3222401G21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67422
Homologene: 32615
Tab1
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 1
Synonyms: Tak1-binding protein 1, 2310012M03Rik, Map3k7ip1, b2b449Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66513
VEGA: 15
Homologene: 4461
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Tead1
Name: TEA domain family member 1
Synonyms: mTEF-1, TEF-1, TEAD-1, Tcf13, Gtrgeo5, B230114H05Rik, 2610024B07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21676
Homologene: 2418
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Ier5
Name: immediate early response 5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15939
HGNC: HGNC:5393
Homologene: 7778
Hoxa5
Name: homeobox A5
Synonyms: Hox-1.3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15402
HGNC: HGNC:5106
Homologene: 40726
St8sia5
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Synonyms: ST8SiaV, Siat8e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225742
Homologene: 8331
Efemp2
Name: epidermal growth factor-containing fibulin-like extracellular matrix protein 2
Synonyms: fibulin 4, MBP1, fibulin-4, 0610011K11Rik, Fbln4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58859
HGNC: HGNC:3219
Homologene: 32339
Adgrf3
Name: adhesion G protein-coupled receptor F3
Synonyms: LOC381628, PGR23, Gpr113
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381628
Homologene: 17826
Eipr1
Name: EARP complex and GARP complex interacting protein 1
Synonyms: D12Ertd604e, Tssc1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380752
VEGA: 12
Homologene: 2481
Hnrnpu
Name: heterogeneous nuclear ribonucleoprotein U
Synonyms: scaffold attachment factor A, Sp120, Hnrpu
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51810
HGNC: HGNC:5048
Homologene: 22991
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Sec63
Name: SEC63 homolog, protein translocation regulator
Synonyms: 5730478J10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140740
Homologene: 5220
Lrch1
Name: leucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms: 4832412D13Rik, Chdc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380916
VEGA: 14
Homologene: 32244
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Nphs2
Name: nephrosis 2, podocin
Synonyms: podocin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170484
Homologene: 22826
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Or8d6
Name: olfactory receptor family 8 subfamily D member 6
Synonyms: GA_x6K02T2PVTD-33640290-33641222, MOR171-1, Olfr974
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259111
VEGA: 9
Homologene: 133680
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 9130019P20Rik, 4933432B13Rik, A530027J04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108857
Homologene: 87006
Gm12887
Name: predicted gene 12887
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666927
Homologene: 111034
Acad11
Name: acyl-Coenzyme A dehydrogenase family, member 11
Synonyms: 5730439E10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102632
Homologene: 49896
Lrrk1
Name: leucine-rich repeat kinase 1
Synonyms: D130026O16Rik, C230002E15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233328
Homologene: 23464
Rin1
Name: Ras and Rab interactor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225870
VEGA: 19
Homologene: 3170
Or5d16
Name: olfactory receptor family 5 subfamily D member 16
Synonyms: GA_x6K02T2Q125-49426894-49425950, MOR174-10, Olfr1155
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258636
Homologene: 133739
Gys2
Name: glycogen synthase 2
Synonyms: LGS, glycogen synthase, liver
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232493
HGNC: HGNC:4707
Homologene: 56580
Ccr8
Name: C-C motif chemokine receptor 8
Synonyms: Cmkbr8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12776
VEGA: 9
HGNC: HGNC:1609
Homologene: 21080
Pde3a
Name: phosphodiesterase 3A, cGMP inhibited
Synonyms: A930022O17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54611
HGNC: HGNC:8778
Homologene: 708
Ccdc121rt3
Name: coiled-coil domain containing 121, retrogene 3
Synonyms: Gm6583
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 625424
Homologene: 116059
Vmn1r9
Name: vomeronasal 1 receptor 9
Synonyms: V1rc30
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171203
Homologene: 76459
Pgap6
Name: post-glycosylphosphatidylinositol attachment to proteins 6
Synonyms: M83, Rxylt1, Tmem8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 60455
Homologene: 10944
Gm15922
Name: predicted gene 15922
Type: Gene
Species: Mouse
Chromosome: 7
Or4a70
Name: olfactory receptor family 4 subfamily A member 70
Synonyms: GA_x6K02T2Q125-50937307-50936387, MOR231-5, Olfr1242
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258970
Homologene: 27316
Tnni2
Name: troponin I, skeletal, fast 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21953
Homologene: 37752
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 155,099,429 bp
  • A to G, chromosome 1 at 156,310,830 bp
  • A to T, chromosome 1 at 178,332,352 bp
  • A to G, chromosome 2 at 27,165,688 bp
  • T to A, chromosome 2 at 82,985,978 bp
  • T to C, chromosome 2 at 87,942,975 bp
  • A to T, chromosome 2 at 89,493,711 bp
  • A to T, chromosome 2 at 114,161,680 bp
  • A to G, chromosome 2 at 168,900,012 bp
  • A to T, chromosome 2 at 178,403,778 bp
  • T to G, chromosome 3 at 138,091,122 bp
  • A to G, chromosome 4 at 5,799,511 bp
  • T to A, chromosome 4 at 121,615,690 bp
  • G to A, chromosome 4 at 133,996,847 bp
  • A to T, chromosome 5 at 30,199,512 bp
  • T to C, chromosome 5 at 32,959,348 bp
  • A to G, chromosome 5 at 112,355,016 bp
  • T to C, chromosome 5 at 114,256,597 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • A to G, chromosome 6 at 52,204,329 bp
  • T to A, chromosome 6 at 57,071,003 bp
  • A to G, chromosome 6 at 141,483,924 bp
  • A to G, chromosome 6 at 142,448,393 bp
  • C to G, chromosome 7 at 3,737,320 bp
  • A to T, chromosome 7 at 66,285,341 bp
  • A to G, chromosome 7 at 112,759,520 bp
  • A to G, chromosome 7 at 142,443,954 bp
  • A to C, chromosome 9 at 20,941,564 bp
  • T to A, chromosome 9 at 39,942,881 bp
  • T to A, chromosome 9 at 104,075,836 bp
  • T to C, chromosome 9 at 120,094,370 bp
  • T to A, chromosome 10 at 42,783,487 bp
  • G to T, chromosome 11 at 9,293,904 bp
  • T to C, chromosome 11 at 107,055,950 bp
  • A to G, chromosome 12 at 28,864,677 bp
  • A to G, chromosome 12 at 103,049,919 bp
  • T to C, chromosome 12 at 110,936,420 bp
  • A to G, chromosome 12 at 115,145,590 bp
  • T to C, chromosome 14 at 74,786,354 bp
  • A to G, chromosome 15 at 66,688,875 bp
  • A to G, chromosome 15 at 80,160,270 bp
  • C to T, chromosome 16 at 22,014,138 bp
  • T to C, chromosome 17 at 26,117,535 bp
  • T to A, chromosome 18 at 36,638,623 bp
  • T to C, chromosome 18 at 37,727,018 bp
  • G to A, chromosome 18 at 77,248,542 bp
  • T to A, chromosome 19 at 5,051,824 bp
  • C to T, chromosome 19 at 5,480,113 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8037 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067474-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.