Loading Mouse GIF
Loading...

Strain Name:
C57BL/6N-Sbf1em1Frobi/Mmucd
Stock Number:
065544-UCD
Citation ID:
RRID:MMRRC_065544-UCD
Other Names:
Mtmr5 deletion

Strain Information

Sbf1em1Frobi
Name: SET binding factor 1; endonuclease-mediated mutation 1, Fred Robinson
Synonyms: Mtmr5-
Type: Allele
Species: Mus musculus (mouse)
Chromosome:
Alteration at locus: CRISPR
Sbf1
Name: SET binding factor 1
Synonyms: 2610510A08Rik, Mtmr5, B230113C15Rik
Type: Gene
Species: Mouse
Chromosome: 15
Alteration at locus: CRISPR
NCBI: 77980
Homologene: 84710
Genetic Alterations
Two CRISPR guide RNAs triggered cuts in both exon 1 and exon 25, leading to a 14-kb deletion that eliminates exons 2-24 and fuses exon 1 to 25. The protein is out-of-frame, causing a premature stop codon in exon 25.
ES Cell Line
Not applicable
Phenotype
Mtmr5-/- nerves had abnormal retention of axons in Remak bundles that would normally be sorted during development for myelination. Mtmr5 was dispensable for subsequent myelination and Mtmr5-/- myelin did not exhibit outfoldings. Deletion of both pseudophosphatases, but not the individual proteins, led to early postnatal lethality. Therefore, Mtmr5 and Mtmr13 had partially redundant functions in other mouse tissues. It was hypothesized that Mtmr5 and Mtmr13 have unique roles in the mouse peripheral nervous system due to differences in expression timing. These findings identify a novel role for Mtmr5 in ensuring radial sorting of large-caliber axons, whereas Mtmr13 subsequently regulates Schwann cell myelination. In addition, Mtmr5-/- male mice are sterile.
Strain Development
The pX330-derived plasmids targeting Exons 1 and 25 were mixed and injected into the pronuclei of single-cell, fertilized mouse embryos of strain C57BL/6NJ (RRID:IMSR_JAX:005304). The embryos were transferred into CD1 pseudo-pregnant recipients. Mutant founder mice were screened by PCR and Sanger DNA sequencing to identify mutations in exon 1, exon 25, as well as large deletions that eliminated the genomic sequence between exons 1 and 25.

The following primers were used for screening:
forward exon 1 primer AMO-49: 5’ CATGCGGAGTGGCCCAAT 3’, reverse exon 1 primer AMO-50: 5’ GGATGTTTCTTACACAGGCCATGT 3’, forward exon 25 primer AMO-51: 5’ CACGGGTTACCAAGGACAAGG 3’, and reverse exon 25 primer AMO-56: 5’ GTCAACTCTGATAGCGAGCACAG 3’.

Mutations were confirmed by TOPO-TA cloning and Sanger DNA sequencing. A founder male was identified as having 14,397-bp deletion that caused exons 1 and 25 to be fused in a manner that yielded a truncated, out-of-frame protein. The mice are not coisogenic, since the founder was crossed with C57BL/6NCrl mice (RRID:IMSR_CRL:027). The allele was then maintained by random intercrossing.
Suggested Control Mice
C57BL/6N
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.
  • Developmental Biology
  • Models for Human Disease
  • Neurobiology
  • Reproduction
  • Sensorineural
Donor
Fred Robinson, Ph.D., Oregon Health & Science University.

Colony and Husbandry Information

At 38 days of age, Mtmr5-/- mice weigh about 70% as much as their sex-matched wild type or Mtmr5+/- littermates. This weight discrepancy is observed in males and females and persists throughout life. It may be necessary to wean Mtmr5-/- pups a little later than 21 days and/or give them soft food for a week or two. The donor did not determine the physiological cause of the smaller size of these mice.

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Random intercrossing
Generation
F7+
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Sterile
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
4 to 6
Recommended wean age
4 Weeks
Average Pups Weaned
4 to 6

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
065544-UCD-EMBRYO Cryo-preserved embryos $1,038.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
065544-UCD-RESUS Litter recovered from cryo-archive $4,044.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.