Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7985Btlr/Mmmh
Stock Number:
046026-MU
Citation ID:
RRID:MMRRC_046026-MU
Other Names:
R7985 (G1)
Major Collection:

Strain Information

Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Calca
Name: calcitonin/calcitonin-related polypeptide, alpha
Synonyms: Cgrp, CA, alpha CGRP, Ctn, Ct, Calc, CT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12310
Homologene: 88337
Psenen
Name: presenilin enhancer gamma secretase subunit
Synonyms: 1700023M09Rik, Pen2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66340
Homologene: 11952
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Dlg1
Name: discs large MAGUK scaffold protein 1
Synonyms: B130052P05Rik, SAP97, Dlgh1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13383
HGNC: HGNC:2900
Homologene: 20869
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Cuedc1
Name: CUE domain containing 1
Synonyms: C330016O16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103841
Homologene: 9933
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Ankrd12
Name: ankyrin repeat domain 12
Synonyms: ANCO-2, GAC-1, 2900001A12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106585
Homologene: 9059
Glcci1
Name: glucocorticoid induced transcript 1
Synonyms: GIG18, 2310047L21Rik, Tssn1, A130036A18Rik, Fam117c
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170772
Homologene: 15773
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Mon2
Name: MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms: SF21, 2610528O22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67074
VEGA: 10
Homologene: 44309
Rpl4
Name: ribosomal protein L4
Synonyms: 2010004J23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67891
VEGA: 9
Homologene: 748
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Zfp408
Name: zinc finger protein 408
Synonyms: LOC381410
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381410
Homologene: 11687
Surf2
Name: surfeit gene 2
Synonyms: Surf-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20931
Homologene: 8430
Itfg1
Name: integrin alpha FG-GAP repeat containing 1
Synonyms: 2310047C21Rik, D8Wsu49e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71927
Homologene: 12423
Esrp1
Name: epithelial splicing regulatory protein 1
Synonyms: 2210008M09Rik, Rbm35a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 207920
Homologene: 9785
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Cyp2c66
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69888
Homologene: 133566
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
C3ar1
Name: complement component 3a receptor 1
Synonyms: anaphylatoxin C3a receptor, C3aR
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12267
HGNC: HGNC:1319
Homologene: 2992
Xpr1
Name: xenotropic and polytropic retrovirus receptor 1
Synonyms: suppressor of yeast Ga deletion, Syg1, Rmc-1, Rmc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19775
Homologene: 134226
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Carmil3
Name: capping protein regulator and myosin 1 linker 3
Synonyms: Lrrc16b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268747
VEGA: 14
Homologene: 74564
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227377
Homologene: 8877
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Slc8a3
Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms: Ncx3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110893
Homologene: 62645
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Ndst2
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms: glucosaminyl N-deacetylase/N-sulphotransferase-2, Mndns, [Heparan sulfate]-glucosamine N-sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17423
VEGA: 14
HGNC: HGNC:7681
Homologene: 20803
Dnai1
Name: dynein axonemal intermediate chain 1
Synonyms: 1110066F04Rik, Dnaic1, b2b1526Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68922
HGNC: HGNC:2954
Homologene: 8122
Adamts1
Name: ADAM metallopeptidase with thrombospondin type 1 motif 1
Synonyms: ADAM-TS1, METH1, METH-1, ADAMTS-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11504
HGNC: HGNC:217
Homologene: 21381
Padi2
Name: peptidyl arginine deiminase, type II
Synonyms: PAD type II, Pdi, Pdi2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18600
Homologene: 7214
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Evi5l
Name: ecotropic viral integration site 5 like
Synonyms: 3110007G05Rik, 1700084G18Rik, 2310039H16Rik, B130050I23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213027
Homologene: 134635
Pycr1
Name: pyrroline-5-carboxylate reductase 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209027
HGNC: HGNC:9721
Homologene: 56002
Klhl33
Name: kelch-like 33
Synonyms: EG546611
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546611
VEGA: 14
Homologene: 52385
Slc22a14
Name: solute carrier family 22 (organic cation transporter), member 14
Synonyms: LOC382113
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382113
HGNC: HGNC:8495
Homologene: 3530
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75721
Homologene: 138468
Shisa6
Name: shisa family member 6
Synonyms: LOC380702, Gm879, CKAMP52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380702
Homologene: 66164
Ugt2b36
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231396
Homologene: 128251
Zfy2
Name: zinc finger protein 2, Y-linked
Synonyms: Zfy-2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22768
Homologene: 56456
Or8b47
Name: olfactory receptor family 8 subfamily B member 47
Synonyms: GA_x6K02T2PVTD-32247224-32248163, GA_x6K02T2PVTD-32223906-32224841, MOR166-1, MOR165-1, Olfr909, Olfr911
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258873
VEGA: 9
Homologene: 74148
Hlx
Name: H2.0-like homeobox
Synonyms: Hlx1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15284
HGNC: HGNC:4978
Homologene: 7363
Nt5el
Name: 5' nucleotidase, ecto-like
Synonyms: 4933425L06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66763
Homologene: 12028
Or2w3b
Name: olfactory receptor family 2 subfamily W member 3B
Synonyms: GA_x6K02T2NKPP-680866-681849, MOR256-47, Olfr317
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257931
Homologene: 128382
Ifi204
Name: interferon activated gene 204
Synonyms: p204
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15951
Homologene: 115929
Allc
Name: allantoicase
Synonyms: 1700012B22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94041
Homologene: 6202
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Nphp1
Name: nephronophthisis 1 (juvenile) homolog (human)
Synonyms: nephrocystin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53885
HGNC: HGNC:7905
Homologene: 229
Csf3
Name: colony stimulating factor 3 (granulocyte)
Synonyms: G-CSF, Csfg, MGI-IG
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12985
HGNC: HGNC:2438
Homologene: 7677
Ebi3
Name: Epstein-Barr virus induced gene 3
Synonyms: IL-27, EBI-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50498
VEGA: 17
HGNC: HGNC:3129
Homologene: 4207
Dguok
Name: deoxyguanosine kinase
Synonyms: dGK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27369
HGNC: HGNC:2858
Homologene: 8456
Habp4
Name: hyaluronic acid binding protein 4
Synonyms: 4933413D03Rik, 4933428J01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56541
VEGA: 13
Homologene: 8615
Gm9767
Name: predicted gene 9767
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100040851
VEGA: 10
Gm3336
Name: predicted gene 3336
Synonyms: 2410018E23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502950
Homologene: 136417
Wdr97
Name: WD repeat domain 97
Synonyms: Gm35339
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 102638882
Homologene: 131539
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,518,727 bp
  • T to C, chromosome 1 at 93,576,524 bp
  • A to G, chromosome 1 at 140,108,826 bp
  • G to A, chromosome 1 at 155,312,895 bp
  • G to A, chromosome 1 at 173,760,206 bp
  • A to G, chromosome 1 at 184,732,026 bp
  • A to G, chromosome 2 at 26,919,276 bp
  • C to A, chromosome 2 at 68,664,349 bp
  • A to T, chromosome 2 at 91,646,431 bp
  • A to G, chromosome 2 at 125,301,878 bp
  • A to T, chromosome 2 at 127,745,909 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • A to T, chromosome 3 at 72,936,961 bp
  • G to A, chromosome 4 at 11,367,153 bp
  • T to C, chromosome 4 at 41,630,055 bp
  • A to T, chromosome 4 at 140,932,092 bp
  • T to C, chromosome 5 at 76,658,050 bp
  • T to A, chromosome 5 at 87,092,124 bp
  • A to G, chromosome 5 at 142,127,847 bp
  • T to C, chromosome 6 at 8,573,186 bp
  • C to T, chromosome 6 at 83,480,932 bp
  • A to T, chromosome 6 at 122,850,005 bp
  • A to T, chromosome 7 at 3,841,697 bp
  • T to C, chromosome 7 at 30,562,078 bp
  • A to G, chromosome 7 at 56,165,244 bp
  • A to G, chromosome 7 at 114,635,178 bp
  • G to T, chromosome 7 at 134,746,954 bp
  • T to A, chromosome 7 at 140,296,893 bp
  • A to G, chromosome 8 at 4,203,536 bp
  • A to G, chromosome 8 at 70,720,527 bp
  • A to G, chromosome 8 at 85,725,568 bp
  • T to A, chromosome 9 at 38,523,943 bp
  • T to A, chromosome 9 at 64,177,930 bp
  • A to C, chromosome 9 at 119,170,638 bp
  • A to G, chromosome 10 at 26,078,783 bp
  • G to T, chromosome 10 at 123,016,308 bp
  • A to G, chromosome 11 at 58,732,706 bp
  • G to T, chromosome 11 at 66,375,164 bp
  • A to T, chromosome 11 at 88,182,516 bp
  • G to A, chromosome 11 at 98,702,447 bp
  • A to G, chromosome 11 at 120,272,891 bp
  • A to T, chromosome 11 at 120,642,920 bp
  • T to G, chromosome 12 at 28,553,972 bp
  • T to A, chromosome 12 at 31,300,215 bp
  • G to A, chromosome 12 at 81,314,993 bp
  • A to T, chromosome 12 at 112,778,963 bp
  • T to A, chromosome 13 at 64,176,046 bp
  • C to T, chromosome 13 at 105,119,974 bp
  • T to C, chromosome 14 at 20,728,410 bp
  • A to T, chromosome 14 at 50,891,505 bp
  • A to G, chromosome 14 at 55,496,952 bp
  • T to C, chromosome 15 at 76,361,487 bp
  • T to A, chromosome 15 at 101,016,962 bp
  • T to G, chromosome 16 at 31,788,105 bp
  • T to C, chromosome 16 at 85,798,114 bp
  • T to A, chromosome 17 at 34,717,010 bp
  • T to G, chromosome 17 at 36,167,553 bp
  • C to T, chromosome 17 at 55,953,997 bp
  • A to G, chromosome 17 at 65,984,196 bp
  • T to A, chromosome 19 at 39,113,986 bp
  • T to C, chromosome Y at 2,116,263 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7985 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.