Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7941Btlr/Mmmh
Stock Number:
045987-MU
Citation ID:
RRID:MMRRC_045987-MU
Other Names:
R7941 (G1)
Major Collection:

Strain Information

Hyal1
Name: hyaluronoglucosaminidase 1
Synonyms: Hyal-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15586
HGNC: HGNC:5320
Homologene: 5277
Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Fam222b
Name: family with sequence similarity 222, member B
Synonyms: BC017647
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216971
Homologene: 10054
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Abl1
Name: c-abl oncogene 1, non-receptor tyrosine kinase
Synonyms: c-Abl, E430008G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11350
HGNC: HGNC:76
Homologene: 3783
Dusp5
Name: dual specificity phosphatase 5
Synonyms: LOC240672
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240672
HGNC: HGNC:3071
Homologene: 3256
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C130057E09Rik, C030046E11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226089
Homologene: 13806
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Klf4
Name: Kruppel-like transcription factor 4 (gut)
Synonyms: Zie, Gklf, EZF
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16600
HGNC: HGNC:6348
Homologene: 3123
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD67, Gad-1, Z49976, EP10, GAD44, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Mpdz
Name: multiple PDZ domain crumbs cell polarity complex component
Synonyms: MUPP1, B930003D11Rik, multiple PDZ domain protein
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17475
HGNC: HGNC:7208
Homologene: 2841
Lsr
Name: lipolysis stimulated lipoprotein receptor
Synonyms: Lisch7, ILDR3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54135
Homologene: 9306
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Usf3
Name: upstream transcription factor family member 3
Synonyms: LOC207806, LOC385650, 5530400K22Rik, Gm608
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207806
Homologene: 19504
Chst10
Name: carbohydrate sulfotransferase 10
Synonyms: ST, Hnk-1st
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98388
Homologene: 21013
AI467606
Name: expressed sequence AI467606
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101602
Homologene: 18492
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Snapc4
Name: small nuclear RNA activating complex, polypeptide 4
Synonyms: 5730436L13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227644
Homologene: 2321
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Vmn2r10
Name: vomeronasal 2, receptor 10
Synonyms: VR16, V2r16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22307
Homologene: 129606
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, Sdccag33, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Skint2
Name: selection and upkeep of intraepithelial T cells 2
Synonyms: OTTMUSG00000008540, B7S3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329919
Homologene: 136741
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Vmn2r92
Name: vomeronasal 2, receptor 92
Synonyms: EG627111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627111
Homologene: 115024
Psg20
Name: pregnancy-specific beta-1-glycoprotein 20
Synonyms: cea7, EG434540
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434540
Homologene: 110989
Prelid2
Name: PRELI domain containing 2
Synonyms: 1700003A01Rik, C330008K14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 77619
VEGA: 18
Homologene: 45749
Or5w11
Name: olfactory receptor family 5 subfamily W member 11
Synonyms: GA_x6K02T2Q125-49133664-49134593, MOR177-4, Olfr1131
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258652
Homologene: 133019
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Rgl2
Name: ral guanine nucleotide dissociation stimulator-like 2
Synonyms: Rlf, KE1.5, Rab2l, Rgt2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19732
HGNC: HGNC:9769
Homologene: 3494
Nfkbiz
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
Synonyms: Mail
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80859
Homologene: 12734
Sh3rf3
Name: SH3 domain containing ring finger 3
Synonyms: 4831416G18Rik, Sh3md4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237353
Homologene: 77551
Fbxl7
Name: F-box and leucine-rich repeat protein 7
Synonyms: Fbl6, FBL7, D230018M15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 448987
VEGA: 15
Homologene: 69121
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105387
Homologene: 138093
Rab24
Name: RAB24, member RAS oncogene family
Synonyms: 6530406O07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19336
VEGA: 13
HGNC: HGNC:9765
Homologene: 40641
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Cabyr
Name: calcium binding tyrosine phosphorylation regulated
Synonyms: FSP-2, CBP86, 4933421A18Rik, 1700016C01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71132
Homologene: 49299
Zbtb39
Name: zinc finger and BTB domain containing 39
Synonyms: 7030401O21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320080
VEGA: 10
Homologene: 8890
Anks1b
Name: ankyrin repeat and sterile alpha motif domain containing 1B
Synonyms: LOC380650, C030032C09Rik, E530015N03Rik, AIDA-1b, Gm10937
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77531
Homologene: 51570
Syndig1
Name: synapse differentiation inducing 1
Synonyms: SynDIG1, Tmem90b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433485
Homologene: 11771
Mettl4
Name: methyltransferase 4, N6-adenosine
Synonyms: HsT661, 2410198H06Rik, A730091E08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76781
VEGA: 17
Homologene: 35305
Svip
Name: small VCP/p97-interacting protein
Synonyms: 1700006C13Rik, 6620401M08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75744
Homologene: 85776
Zscan4-ps2
Name: zinc finger and SCAN domain containing 4, pseudogene 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665913
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 38,871,691 bp
  • A to G, chromosome 1 at 150,650,084 bp
  • A to G, chromosome 1 at 189,657,286 bp
  • A to G, chromosome 2 at 26,376,718 bp
  • T to C, chromosome 2 at 31,689,679 bp
  • T to A, chromosome 2 at 70,594,585 bp
  • A to G, chromosome 2 at 76,919,350 bp
  • T to C, chromosome 2 at 87,628,904 bp
  • T to G, chromosome 2 at 101,642,346 bp
  • T to A, chromosome 2 at 149,899,788 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • G to A, chromosome 4 at 55,531,755 bp
  • A to G, chromosome 4 at 81,282,750 bp
  • A to T, chromosome 4 at 100,988,173 bp
  • C to A, chromosome 4 at 112,625,990 bp
  • A to G, chromosome 5 at 6,770,042 bp
  • A to T, chromosome 5 at 93,638,028 bp
  • A to T, chromosome 5 at 108,996,440 bp
  • A to G, chromosome 7 at 11,517,672 bp
  • T to A, chromosome 7 at 18,681,177 bp
  • T to G, chromosome 7 at 30,973,095 bp
  • T to C, chromosome 7 at 52,003,413 bp
  • T to A, chromosome 7 at 83,682,829 bp
  • A to G, chromosome 7 at 127,092,421 bp
  • GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT to GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT, chromosome 7 at 127,558,290 bp
  • A to G, chromosome 9 at 22,036,316 bp
  • T to C, chromosome 9 at 107,578,100 bp
  • T to C, chromosome 9 at 108,024,432 bp
  • C to T, chromosome 10 at 41,409,137 bp
  • T to C, chromosome 10 at 59,007,061 bp
  • A to T, chromosome 10 at 90,577,155 bp
  • A to T, chromosome 10 at 107,806,802 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • A to G, chromosome 10 at 127,743,540 bp
  • A to T, chromosome 11 at 74,659,757 bp
  • G to T, chromosome 11 at 78,155,059 bp
  • A to G, chromosome 13 at 4,059,713 bp
  • C to T, chromosome 13 at 55,320,307 bp
  • A to G, chromosome 15 at 26,543,613 bp
  • T to C, chromosome 16 at 44,215,561 bp
  • C to T, chromosome 16 at 55,821,944 bp
  • T to C, chromosome 17 at 18,184,837 bp
  • T to C, chromosome 17 at 33,931,739 bp
  • T to C, chromosome 17 at 33,999,331 bp
  • A to T, chromosome 17 at 94,733,194 bp
  • T to C, chromosome 18 at 12,744,768 bp
  • T to C, chromosome 18 at 38,199,080 bp
  • A to T, chromosome 18 at 41,932,751 bp
  • A to T, chromosome 18 at 84,015,392 bp
  • T to C, chromosome 19 at 10,271,503 bp
  • T to C, chromosome 19 at 29,533,259 bp
  • A to G, chromosome 19 at 53,537,533 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7941 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045987-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.