Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7859Btlr/Mmmh
Stock Number:
045912-MU
Citation ID:
RRID:MMRRC_045912-MU
Other Names:
R7859 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Crkl
Name: v-crk avian sarcoma virus CT10 oncogene homolog-like
Synonyms: Crkol, 1110025F07Rik, snoop
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12929
HGNC: HGNC:2363
Homologene: 38021
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Atxn10
Name: ataxin 10
Synonyms: TEG-169, E46, Sca10, Tex169
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54138
VEGA: 15
Homologene: 40858
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: Sp6, Phxr3, mbo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Sema4d
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: semaphorin H, M-sema G, coll-4, CD100, Semcl2, Semaj, Semacl2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20354
Homologene: 21282
Myo1d
Name: myosin ID
Synonyms: 9930104H07Rik, D11Ertd9e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338367
HGNC: HGNC:7598
Homologene: 45576
Cd300a
Name: CD300A molecule
Synonyms: Pigr4, MMAC8, Clm8, LMIR1, B230315M08Rik, MAIR-I
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217303
Homologene: 48514
Usp54
Name: ubiquitin specific peptidase 54
Synonyms: 4930429G18Rik, C030002J06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78787
Homologene: 90902
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Nkx2-2
Name: NK2 homeobox 2
Synonyms: tinman, Nkx-2.2, Nkx2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18088
HGNC: HGNC:7835
Homologene: 1879
Ipcef1
Name: interaction protein for cytohesin exchange factors 1
Synonyms: A130090K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320495
Homologene: 32271
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: D28, PTPROt, PTP-phi, PTP-BK, PTP-U2, GLEPP1, PTP-oc, Ptpn15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Tpo
Name: thyroid peroxidase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22018
Homologene: 461
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Tex22
Name: testis expressed gene 22
Synonyms: Tep22, 1700028O09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75671
Homologene: 84861
Taar4
Name: trace amine-associated receptor 4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209513
Homologene: 45509
Nat2
Name: N-acetyltransferase 2 (arylamine N-acetyltransferase)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17961
Homologene: 37329
Slc25a29
Name: solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29
Synonyms: mCACL, CACL, C030003J19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 214663
Homologene: 5385
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232367
Arsb
Name: arylsulfatase B
Synonyms: Ast-1, As-1s, As-1, As-1t, Asr-1, As-1r, As1-t, As1-r, As1, As1-s, 1110007C02Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11881
VEGA: 13
HGNC: HGNC:714
Homologene: 73870
Or5b12
Name: olfactory receptor family 5 subfamily B member 12
Synonyms: GA_x6K02T2RE5P-3249780-3248836, MOR202-5, Olfr1448
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258696
Homologene: 64904
Mcur1
Name: mitochondrial calcium uniporter regulator 1
Synonyms: 6230416A05Rik, Ccdc90a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76137
VEGA: 13
Homologene: 134447
Psg28
Name: pregnancy-specific beta-1-glycoprotein 28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 114871
Homologene: 110989
Dusp22
Name: dual specificity phosphatase 22
Synonyms: JKAP, 1110028K04Rik, JSP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105352
Homologene: 86039
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434285
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 637021
Homologene: 115024
Slc22a22
Name: solute carrier family 22 (organic cation transporter), member 22
Synonyms: OAT-PG, BC026439
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210463
Homologene: 18166
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Dlgap1
Name: DLG associated protein 1
Synonyms: SAPAP1, DAP-1 beta, D17Bwg0511e, GKAP/SAPAP, Sapap1, 4933422O14Rik, Gkap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
Nrsn1
Name: neurensin 1
Synonyms: Vmp, Neuro-p24, Neurensin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22360
Homologene: 7597
Evi2a
Name: ecotropic viral integration site 2a
Synonyms: Evi-2, Evi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14017
HGNC: HGNC:3499
Homologene: 49234
Slc43a1
Name: solute carrier family 43, member 1
Synonyms: PB39, 2610016F07Rik, Pov1, Lat3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72401
HGNC: HGNC:9225
Homologene: 2688
Pax8
Name: paired box 8
Synonyms: Pax-8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18510
HGNC: HGNC:8622
Homologene: 2589
Nrl
Name: neural retina leucine zipper gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18185
VEGA: 14
HGNC: HGNC:8002
Homologene: 4501
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 11,080,050 bp
  • T to A, chromosome 2 at 24,421,555 bp
  • T to C, chromosome 2 at 84,856,876 bp
  • A to G, chromosome 2 at 147,177,810 bp
  • T to C, chromosome 3 at 122,949,766 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • T to C, chromosome 5 at 9,128,044 bp
  • T to A, chromosome 6 at 40,740,179 bp
  • A to T, chromosome 6 at 124,224,242 bp
  • G to A, chromosome 6 at 137,392,807 bp
  • A to T, chromosome 7 at 18,426,224 bp
  • T to C, chromosome 7 at 55,900,026 bp
  • A to T, chromosome 7 at 139,920,964 bp
  • G to A, chromosome 7 at 141,645,420 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • T to A, chromosome 8 at 67,501,350 bp
  • G to T, chromosome 10 at 5,157,683 bp
  • T to A, chromosome 10 at 6,890,569 bp
  • T to C, chromosome 10 at 23,961,134 bp
  • T to C, chromosome 11 at 67,186,700 bp
  • T to C, chromosome 11 at 79,527,626 bp
  • T to G, chromosome 11 at 80,684,377 bp
  • T to C, chromosome 11 at 114,893,339 bp
  • T to A, chromosome 12 at 30,100,574 bp
  • G to A, chromosome 12 at 108,826,830 bp
  • T to A, chromosome 12 at 113,088,483 bp
  • A to C, chromosome 13 at 25,262,271 bp
  • A to C, chromosome 13 at 30,708,754 bp
  • G to A, chromosome 13 at 43,560,009 bp
  • T to A, chromosome 13 at 51,722,351 bp
  • A to G, chromosome 13 at 67,306,381 bp
  • T to A, chromosome 13 at 93,862,107 bp
  • T to C, chromosome 14 at 20,588,136 bp
  • G to A, chromosome 14 at 55,522,125 bp
  • A to T, chromosome 15 at 57,250,952 bp
  • A to G, chromosome 15 at 85,462,325 bp
  • T to A, chromosome 16 at 17,469,096 bp
  • A to G, chromosome 17 at 18,061,950 bp
  • G to T, chromosome 17 at 20,541,174 bp
  • T to C, chromosome 17 at 24,384,526 bp
  • T to A, chromosome 17 at 24,571,280 bp
  • A to G, chromosome 17 at 70,516,688 bp
  • T to A, chromosome 19 at 12,919,982 bp
  • T to A, chromosome 19 at 21,832,175 bp
  • G to A, chromosome 19 at 25,183,570 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7859 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045912-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.