Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7855Btlr/Mmmh
Stock Number:
045908-MU
Citation ID:
RRID:MMRRC_045908-MU
Other Names:
R7855 (G1)
Major Collection:

Strain Information

Mitf
Name: melanogenesis associated transcription factor
Synonyms: mi, wh, BCC2, bHLHe32, Gsfbcc2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17342
HGNC: HGNC:7105
Homologene: 4892
Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: bf, 3830421M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77573
Homologene: 11294
Itgb8
Name: integrin beta 8
Synonyms: 4832412O06Rik, D630049N15
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320910
HGNC: HGNC:6163
Homologene: 18567
Bcl2l2
Name: BCL2-like 2
Synonyms: bclw, Gtrgal2, Gtrosa41, Bcl-w
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12050
Homologene: 2989
Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Skp2
Name: S-phase kinase-associated protein 2
Synonyms: FBXL1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27401
Homologene: 55942
Coro1c
Name: coronin, actin binding protein 1C
Synonyms: coronin 3, CRN2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23790
HGNC: HGNC:2254
Homologene: 56537
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Smarcd2
Name: SWI/SNF related BAF chromatin remodeling complex subunit D2
Synonyms: Baf60b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83796
Homologene: 20671
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: 0710008O11Rik, BRMS1, D12Ertd407e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Il2ra
Name: interleukin 2 receptor, alpha chain
Synonyms: IL-2R alpha chain, CD25, Ly-43, Il2r
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16184
HGNC: HGNC:6008
Homologene: 360
Cpxm2
Name: carboxypeptidase X, M14 family member 2
Synonyms: 4632435C11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55987
Homologene: 69259
Lctl
Name: lactase-like
Synonyms: KLPH, E130104I05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235435
Homologene: 70710
Zfta
Name: zinc finger translocation associated
Synonyms: 2700081O15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 108899
Homologene: 52179
Prdm10
Name: PR domain containing 10
Synonyms: tristanin, LOC382066
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382066
Homologene: 45718
Rhbdf2
Name: rhomboid 5 homolog 2
Synonyms: 4732465I17Rik, Rhbdl6, iRhom2, cub, Uncv
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217344
Homologene: 11612
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Elf3
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Eln
Name: elastin
Synonyms: tropoelastin, E030024M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13717
HGNC: HGNC:3327
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Rasgrp4
Name: RAS guanyl releasing protein 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233046
Homologene: 15635
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Semp2l1
Name: SUMO/sentrin specific peptidase 2-like 1
Synonyms: Gm5415
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 408191
Homologene: 130042
Kcnh7
Name: potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms: Kv11.3, erg3, 9330137I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170738
Homologene: 13249
Simc1
Name: SUMO-interacting motifs containing 1
Synonyms: 4732471D19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319719
Homologene: 131217
Zfp467
Name: zinc finger protein 467
Synonyms: MNCb-3350, EZI, 1190001I08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68910
Homologene: 10758
Ptpre
Name: protein tyrosine phosphatase receptor type E
Synonyms: PTPe, PTPepsilon, RPTPepsilon
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19267
HGNC: HGNC:9669
Homologene: 31387
Gfer
Name: growth factor, augmenter of liver regeneration
Synonyms: ERV1, Alr
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11692
VEGA: 17
HGNC: HGNC:4236
Homologene: 55884
Vmn2r96
Name: vomeronasal 2, receptor 96
Synonyms: EG433070
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433070
Ttll13
Name: tubulin tyrosine ligase-like family, member 13
Synonyms: 1700111A04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269954
Homologene: 136186
Or52r1
Name: olfactory receptor family 52 subfamily R member 1
Synonyms: GA_x6K02T2PBJ9-5599295-5598351, MOR30-1, Olfr569
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259092
Homologene: 17500
Ace
Name: angiotensin I converting enzyme
Synonyms: CD143
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11421
HGNC: HGNC:2707
Homologene: 37351
Dipk1c
Name: divergent protein kinase domain 1C
Synonyms: B230399E16Rik, Fam69c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240479
Homologene: 45477
Pinlyp
Name: phospholipase A2 inhibitor and LY6/PLAUR domain containing
Synonyms: 2310033E01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 641361
Homologene: 53159
Cd38
Name: CD38 antigen
Synonyms: Cd38-rs1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12494
HGNC: HGNC:1667
Homologene: 1345
Or51v14
Name: olfactory receptor family 51 subfamily V member 14
Synonyms: GA_x6K02T2PBJ9-6335095-6334154, MOR4-1, Olfr620
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258808
Homologene: 103777
Zfp354c
Name: zinc finger protein 354C
Synonyms: Kid3, AJ18, 5330421P20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Pskh1
Name: protein serine kinase H1
Synonyms: E130013P03Rik, b2b1230Clo
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244631
HGNC: HGNC:9529
Homologene: 48461
Bicdl2
Name: BICD family like cargo adaptor 2
Synonyms: Ccdc64b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 212733
VEGA: 17
Homologene: 17815
Polh
Name: polymerase (DNA directed), eta (RAD 30 related)
Synonyms: RAD30A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 80905
VEGA: 17
HGNC: HGNC:9181
Homologene: 38189
Vmn1r55
Name: vomeronasal 1 receptor 55
Synonyms: LOC236535, LOC384522, V1rd5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384522
Homologene: 41799
Pramel51
Name: PRAME like 51
Synonyms: Gm10436
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039315
VEGA: 12
Homologene: 103830
Zfp1002
Name: zinc finger protein 1002
Synonyms: Gm21994
Type: Gene
Species: Mouse
Chromosome: 2
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 32,546,033 bp
  • A to C, chromosome 1 at 40,343,119 bp
  • A to G, chromosome 1 at 66,483,349 bp
  • G to T, chromosome 1 at 90,810,621 bp
  • G to A, chromosome 1 at 135,254,352 bp
  • T to C, chromosome 2 at 11,680,336 bp
  • G to A, chromosome 2 at 62,837,194 bp
  • C to T, chromosome 2 at 150,255,146 bp
  • T to A, chromosome 2 at 160,714,088 bp
  • T to G, chromosome 3 at 86,315,430 bp
  • T to C, chromosome 4 at 121,182,691 bp
  • C to A, chromosome 5 at 43,901,448 bp
  • A to T, chromosome 5 at 113,848,597 bp
  • G to A, chromosome 5 at 123,570,979 bp
  • AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC to AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC, chromosome 5 at 134,711,081 bp
  • T to C, chromosome 6 at 48,439,181 bp
  • C to T, chromosome 6 at 70,704,069 bp
  • T to A, chromosome 6 at 97,993,196 bp
  • A to G, chromosome 7 at 5,146,624 bp
  • C to T, chromosome 7 at 24,542,440 bp
  • C to T, chromosome 7 at 29,150,610 bp
  • C to T, chromosome 7 at 80,254,097 bp
  • A to G, chromosome 7 at 96,873,874 bp
  • A to G, chromosome 7 at 102,887,628 bp
  • T to A, chromosome 7 at 103,611,772 bp
  • G to T, chromosome 7 at 132,057,695 bp
  • A to G, chromosome 7 at 135,651,995 bp
  • G to T, chromosome 8 at 105,913,090 bp
  • A to G, chromosome 9 at 31,327,474 bp
  • A to C, chromosome 9 at 64,133,216 bp
  • A to C, chromosome 11 at 34,273,698 bp
  • TCACACTCGGCACA to TCACA, chromosome 11 at 50,815,240 bp
  • A to T, chromosome 11 at 99,858,184 bp
  • A to T, chromosome 11 at 105,972,379 bp
  • T to C, chromosome 11 at 106,267,566 bp
  • A to G, chromosome 11 at 106,671,750 bp
  • A to T, chromosome 11 at 110,191,628 bp
  • G to T, chromosome 11 at 116,602,240 bp
  • A to T, chromosome 12 at 55,866,053 bp
  • A to T, chromosome 12 at 88,176,083 bp
  • C to T, chromosome 12 at 119,166,772 bp
  • T to A, chromosome 13 at 11,706,623 bp
  • A to G, chromosome 13 at 54,524,832 bp
  • A to T, chromosome 13 at 67,619,948 bp
  • G to T, chromosome 14 at 26,829,329 bp
  • C to T, chromosome 14 at 54,884,379 bp
  • A to G, chromosome 15 at 9,122,241 bp
  • A to G, chromosome 15 at 9,687,895 bp
  • G to T, chromosome 16 at 14,114,201 bp
  • A to G, chromosome 16 at 63,773,560 bp
  • T to A, chromosome 17 at 18,597,868 bp
  • C to T, chromosome 17 at 23,666,017 bp
  • C to A, chromosome 17 at 24,694,285 bp
  • G to A, chromosome 17 at 46,175,248 bp
  • G to A, chromosome 18 at 84,730,046 bp
  • T to A, chromosome 19 at 7,422,256 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7855 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045908-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.