Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7820Btlr/Mmmh
Stock Number:
045874-MU
Citation ID:
RRID:MMRRC_045874-MU
Other Names:
R7820 (G1)
Major Collection:

Strain Information

Crhr2
Name: corticotropin releasing hormone receptor 2
Synonyms: Crfr2, CRF-R2, CRFR2beta, CRFR2alpha, CRF 2 receptor, CRH-R2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12922
HGNC: HGNC:2358
Homologene: 55612
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Slit3
Name: slit guidance ligand 3
Synonyms: Slit1, b2b2362.1Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20564
Homologene: 2303
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Plekha7
Name: pleckstrin homology domain containing, family A member 7
Synonyms: A430081P20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233765
Homologene: 52172
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Hmgxb4
Name: HMG box domain containing 4
Synonyms: 4733401K04Rik, Hmgb2l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70823
HGNC: HGNC:5003
Homologene: 4007
Pms2
Name: PMS1 homolog2, mismatch repair system component
Synonyms: mismatch repair, DNA mismatch repair
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18861
Homologene: 133560
Adam12
Name: ADAM metallopeptidase domain 12
Synonyms: Mltna, ADAM12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11489
HGNC: HGNC:190
Homologene: 74862
Clca4a
Name: chloride channel accessory 4A
Synonyms: 9130020L07Rik, Clca6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99663
HGNC: HGNC:2018
Homologene: 40808
Mon1a
Name: MON1 homolog A, secretory traffciking associated
Synonyms: 2810468K17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72825
Homologene: 7191
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Pou4f2
Name: POU domain, class 4, transcription factor 2
Synonyms: Brn-3.2, Brn-3b, mBrn3-3R, Brn3b, Pou4f-rs1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18997
HGNC: HGNC:9219
Homologene: 20959
Oca2
Name: oculocutaneous albinism II
Synonyms: D7H15S12, D7H15S12, p
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18431
HGNC: HGNC:8101
Homologene: 37281
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Eml1
Name: echinoderm microtubule associated protein like 1
Synonyms: ELP79, 1110008N23Rik, A930030P13Rik, heco
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68519
HGNC: HGNC:3330
Homologene: 20931
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268288
VEGA: 10
Homologene: 67991
Cimap1a
Name: ciliary microtubule associated protein 1A
Synonyms: SHIPPO1, 1700011O04Rik, Odf3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69287
Homologene: 12306
Naip1
Name: NLR family, apoptosis inhibitory protein 1
Synonyms: D13Lsd1, Naip, Birc1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17940
VEGA: 13
HGNC: HGNC:7634
Homologene: 113589
Sorbs2
Name: sorbin and SH3 domain containing 2
Synonyms: 9430041O17Rik, 2010203O03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234214
Homologene: 83295
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Kif2b
Name: kinesin family member 2B
Synonyms: 1700063D03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73470
Homologene: 23775
Or4c119
Name: olfactory receptor family 4 subfamily C member 119
Synonyms: GA_x6K02T2Q125-50635980-50635046, MOR233-15, Olfr1224
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258026
Tas2r125
Name: taste receptor, type 2, member 125
Synonyms: Tas2r25, T2R26, mGR25, mt2r59
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387352
Homologene: 87294
Mfap5
Name: microfibrillar associated protein 5
Synonyms: MAGP-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50530
Homologene: 2599
Cacnb2
Name: calcium channel, voltage-dependent, beta 2 subunit
Synonyms: Cchb2, Cavbeta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12296
HGNC: HGNC:1402
Homologene: 75191
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Eef1akmt3
Name: EEF1A lysine methyltransferase 3
Synonyms: EG546486, Gm16109, Fam119b, Mettl21b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100504608
Homologene: 79538
Speer4f1
Name: spermatogenesis associated glutamate (E)-rich protein 4F1
Synonyms: SPEER-4F, 4922502J04Rik, Speer4f
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70935
Homologene: 69402
Vmn1r215
Name: vomeronasal 1 receptor 215
Synonyms: V1ri2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171253
Homologene: 110880
Ankfn1
Name: ankyrin-repeat and fibronectin type III domain containing 1
Synonyms: LOC382543, 4932411E22Rik, nmf9, mWAKE
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 382543
Homologene: 34996
Ngp
Name: neutrophilic granule protein
Synonyms: clone B6, myeloid granule protein, bectenecin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18054
Homologene: 49180
Ovgp1
Name: oviductal glycoprotein 1
Synonyms: MOGP, muc9, mucin 9, oviductin, Chit5, OGP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12659
HGNC: HGNC:8524
Homologene: 74442
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Mcm8
Name: minichromosome maintenance 8 homologous recombination repair factor
Synonyms: 5730432L01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66634
Homologene: 12001
Pdc
Name: phosducin
Synonyms: Pdc, Rpr-1, Rpr1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20028
HGNC: HGNC:8759
Homologene: 1950
Or11a4
Name: olfactory receptor family 11 subfamily A member 4
Synonyms: MOR121-1, GA_x6K02T2PSCP-1665046-1665987, Olfr96
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258507
HGNC: HGNC:8176
Homologene: 27189
Plppr4
Name: phospholipid phosphatase related 4
Synonyms: D3Bwg0562e, Lppr4, PRG-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229791
Homologene: 8895
Vmn1r71
Name: vomeronasal 1 receptor 71
Synonyms: V1re13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252910
Homologene: 74352
Repin1
Name: replication initiator 1
Synonyms: AP4, E430037F08Rik, Zfp464
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58887
Homologene: 22810
Zfp764l1
Name: zinc finger protein 764 like 1
Synonyms: E430018J23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101604
Homologene: 138471
Zfp128
Name: zinc finger protein 128
Synonyms: mZnf8, 9630016P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243833
Homologene: 10889
Or8b3
Name: olfactory receptor family 8 subfamily B member 3
Synonyms: M3, MOR164-1, GA_x6K02T2PVTD-32098059-32099003, Olfr147
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258869
VEGA: 9
Homologene: 128279
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Mtx1
Name: metaxin 1
Synonyms: Gcap6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17827
HGNC: HGNC:7504
Homologene: 37623
Ighv16-1
Name: immunoglobulin heavy variable 16-1
Synonyms: Gm7005
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629812
Spin2f
Name: spindlin family, member 2F
Synonyms: Gm2790
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 108168466
VEGA: X
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 150,333,270 bp
  • T to A, chromosome 2 at 14,960,666 bp
  • A to G, chromosome 2 at 20,863,172 bp
  • T to A, chromosome 2 at 89,156,248 bp
  • A to G, chromosome 2 at 132,840,772 bp
  • G to T, chromosome 3 at 89,214,008 bp
  • A to G, chromosome 3 at 105,986,521 bp
  • A to G, chromosome 3 at 117,321,949 bp
  • A to T, chromosome 3 at 144,960,671 bp
  • T to A, chromosome 5 at 17,479,530 bp
  • T to G, chromosome 5 at 143,914,633 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • A to C, chromosome 6 at 55,102,779 bp
  • C to A, chromosome 6 at 122,520,921 bp
  • T to G, chromosome 6 at 132,909,878 bp
  • A to G, chromosome 7 at 10,748,725 bp
  • A to G, chromosome 7 at 12,891,022 bp
  • A to G, chromosome 7 at 28,120,359 bp
  • T to A, chromosome 7 at 50,599,623 bp
  • A to T, chromosome 7 at 56,331,965 bp
  • A to T, chromosome 7 at 116,237,480 bp
  • A to T, chromosome 7 at 120,212,721 bp
  • A to T, chromosome 7 at 127,391,436 bp
  • A to G, chromosome 7 at 133,998,188 bp
  • A to C, chromosome 7 at 140,849,263 bp
  • A to T, chromosome 8 at 33,575,062 bp
  • A to T, chromosome 8 at 45,796,556 bp
  • G to T, chromosome 8 at 75,000,946 bp
  • T to A, chromosome 8 at 78,436,502 bp
  • A to T, chromosome 9 at 38,403,566 bp
  • T to C, chromosome 9 at 107,901,312 bp
  • A to G, chromosome 9 at 110,420,864 bp
  • T to A, chromosome 10 at 26,233,518 bp
  • T to C, chromosome 10 at 127,033,194 bp
  • A to G, chromosome 11 at 35,700,408 bp
  • A to T, chromosome 11 at 69,353,238 bp
  • G to T, chromosome 11 at 89,421,130 bp
  • A to G, chromosome 11 at 91,577,274 bp
  • T to A, chromosome 11 at 115,339,588 bp
  • T to C, chromosome 12 at 108,515,174 bp
  • T to C, chromosome 12 at 114,068,969 bp
  • A to T, chromosome 13 at 23,076,545 bp
  • A to T, chromosome 13 at 63,523,061 bp
  • C to T, chromosome 13 at 99,431,177 bp
  • G to A, chromosome 13 at 100,423,070 bp
  • G to A, chromosome 13 at 102,754,088 bp
  • C to T, chromosome 15 at 80,372,372 bp
  • T to A, chromosome 17 at 26,205,195 bp
  • A to T, chromosome 17 at 37,225,895 bp
  • C to T, chromosome 19 at 21,807,461 bp
  • A to G, chromosome X at 31,254,699 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7820 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045874-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.