Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7714Btlr/Mmmh
Stock Number:
045772-MU
Citation ID:
RRID:MMRRC_045772-MU
Other Names:
R7714 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Gapdhs
Name: glyceraldehyde-3-phosphate dehydrogenase, spermatogenic
Synonyms: Gapd-s, Gapds
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14447
Homologene: 101265
Rad51c
Name: RAD51 paralog C
Synonyms: Rad51l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114714
HGNC: HGNC:9820
Homologene: 14238
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Pabpc4
Name: poly(A) binding protein, cytoplasmic 4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230721
HGNC: HGNC:8557
Homologene: 37855
Sdad1
Name: SDA1 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231452
Homologene: 6036
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Chek2
Name: checkpoint kinase 2
Synonyms: CHK2, Rad53
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50883
Homologene: 38289
Ttll4
Name: tubulin tyrosine ligase-like family, member 4
Synonyms: 4632407P03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67534
Homologene: 8764
Iws1
Name: IWS1, SUPT6 interacting protein
Synonyms: 1700069O15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73473
Homologene: 134421
Ccdc3
Name: coiled-coil domain containing 3
Synonyms: 2310045O21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74186
Homologene: 12870
Arfgap3
Name: ARF GTPase activating protein 3
Synonyms: 1810004P07Rik, 1810035F16Rik, 0610009H19Rik, 9130416J18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66251
VEGA: 15
HGNC: HGNC:661
Homologene: 134103
Magel2
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Bach1
Name: BTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms: 6230421P05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12013
HGNC: HGNC:935
Homologene: 916
Tcerg1
Name: transcription elongation regulator 1 (CA150)
Synonyms: p144, ca150, Taf2s, 2410022J09Rik, 2900090C16Rik, Fbp28
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56070
Homologene: 4879
Zfp599
Name: zinc finger protein 599
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235048
Homologene: 138456
Parm1
Name: prostate androgen-regulated mucin-like protein 1
Synonyms: 2210012L08Rik, 9130213B05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231440
Homologene: 41036
Pmch
Name: pro-melanin-concentrating hormone
Synonyms: MCH, melanin-concentrating hormone, A230109K23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110312
Homologene: 37653
Prf1
Name: perforin 1 (pore forming protein)
Synonyms: perforin, Prf-1, Pfp, Pfn
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18646
VEGA: 10
HGNC: HGNC:9360
Homologene: 3698
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64580
Homologene: 11208
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Mob3b
Name: MOB kinase activator 3B
Synonyms: MOB3B, A430018A01Rik, 8430436F23Rik, Mobkl2b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214944
Homologene: 69385
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70417
Homologene: 23771
Cracdl
Name: capping protein inhibiting regulator of actin like
Synonyms: 2010300C02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72097
Homologene: 19208
Pilra
Name: paired immunoglobin-like type 2 receptor alpha
Synonyms: FDF03
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231805
Homologene: 8387
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: LOC380730, Gm884
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Tmem273
Name: transmembrane protein 273
Synonyms: 1810011H11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69069
VEGA: 14
Homologene: 78635
Dgkb
Name: diacylglycerol kinase, beta
Synonyms: DGK-beta, C630029D13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217480
VEGA: 12
HGNC: HGNC:2850
Homologene: 37875
Rnpepl1
Name: arginyl aminopeptidase (aminopeptidase B)-like 1
Synonyms: 1110014H17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108657
Homologene: 36367
Myo1c
Name: myosin IC
Synonyms: myosin-Ibeta, myr2, C80397, mm1beta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17913
HGNC: HGNC:7597
Homologene: 32046
Rufy2
Name: RUN and FYVE domain-containing 2
Synonyms: LZ-FYVE, 2610111M19Rik, Denn, ZFYVE13
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70432
Homologene: 23064
Hoxb3
Name: homeobox B3
Synonyms: Hox-2.7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15410
HGNC: HGNC:5114
Homologene: 1617
Tas2r126
Name: taste receptor, type 2, member 126
Synonyms: Tas2r26, mGR26, T2R12, mt2r35, T2R26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387353
Homologene: 16412
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Vmn2r53
Name: vomeronasal 2, receptor 53
Synonyms: EG637908
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637908
Homologene: 104040
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: TJ6s, Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: A930019K20Rik, C430014H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Adam22
Name: a disintegrin and metallopeptidase domain 22
Synonyms: MDC2, 2900022I03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11496
HGNC: HGNC:201
Homologene: 37898
Cd226
Name: CD226 antigen
Synonyms: TLiSA1, DNAM-1, DNAM1, Pta1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225825
Homologene: 4787
Ehhadh
Name: enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
Synonyms: HD, MFP, L-bifunctional enzyme, L-PBE, 1300002P22Rik, MFP1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74147
HGNC: HGNC:3247
Homologene: 1486
Cbr2
Name: carbonyl reductase 2
Synonyms: MLCR, lung carbonyl reductase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12409
Homologene: 104184
Rassf8
Name: Ras association (RalGDS/AF-6) domain family (N-terminal) member 8
Synonyms: mHoj-1, 5133400D11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71323
Homologene: 5219
Or5b116
Name: olfactory receptor family 5 subfamily B member 116
Synonyms: GA_x6K02T2RE5P-3777626-3778570, MOR202-38, MOR202-47_p, Olfr1471
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258231
Homologene: 79417
Fnip2
Name: folliculin interacting protein 2
Synonyms: D630023B12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329679
Homologene: 46417
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur-6, Glur6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: A230107C01Rik, Catsperg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Gpd1
Name: glycerol-3-phosphate dehydrogenase 1 (soluble)
Synonyms: Gdc-1, Gdc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14555
HGNC: HGNC:4455
Homologene: 5593
Or10aa1
Name: olfactory receptor family 10 subfamily AA member 1
Synonyms: GA_x6K02T2P20D-21133014-21132070, MOR123-1, Olfr433
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258712
Homologene: 133588
Lipf
Name: lipase, gastric
Synonyms: 2310051B21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67717
HGNC: HGNC:6622
Homologene: 68139
Wnt6
Name: wingless-type MMTV integration site family, member 6
Synonyms: Wnt-6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22420
Homologene: 4756
Vash1
Name: vasohibin 1
Synonyms: G630009D10Rik, D930046M13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238328
Homologene: 8941
Tac4
Name: tachykinin 4
Synonyms: hemokinin I (HK-1), PPT-C
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93670
Homologene: 50484
Vmn2r40
Name: vomeronasal 2, receptor 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042781
Homologene: 113703
Fer1l5
Name: fer-1 like family member 5
Synonyms: 4930533C12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100534273
Homologene: 85232
Trav13-4-dv7
Name: T cell receptor alpha variable 13-4-DV7
Synonyms: Gm13934
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100113412
Trav8d-1
Name: T cell receptor alpha variable 8D-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 667476
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 36,401,477 bp
  • T to A, chromosome 1 at 37,624,777 bp
  • C to T, chromosome 1 at 74,679,413 bp
  • T to C, chromosome 1 at 74,784,263 bp
  • A to G, chromosome 1 at 92,917,168 bp
  • C to T, chromosome 1 at 132,456,876 bp
  • G to A, chromosome 1 at 174,042,334 bp
  • A to T, chromosome 2 at 5,229,097 bp
  • T to A, chromosome 2 at 31,922,267 bp
  • T to C, chromosome 3 at 59,093,586 bp
  • A to C, chromosome 3 at 79,518,114 bp
  • A to G, chromosome 3 at 118,804,131 bp
  • A to T, chromosome 3 at 125,570,844 bp
  • G to A, chromosome 4 at 32,722,360 bp
  • A to G, chromosome 4 at 35,083,872 bp
  • T to C, chromosome 4 at 63,324,486 bp
  • G to A, chromosome 4 at 123,295,309 bp
  • T to A, chromosome 4 at 128,382,950 bp
  • C to A, chromosome 4 at 156,195,397 bp
  • A to G, chromosome 5 at 8,117,587 bp
  • A to G, chromosome 5 at 25,375,366 bp
  • A to G, chromosome 5 at 30,370,253 bp
  • C to T, chromosome 5 at 91,593,932 bp
  • A to T, chromosome 5 at 92,302,679 bp
  • T to C, chromosome 5 at 110,841,453 bp
  • C to T, chromosome 5 at 115,595,300 bp
  • C to T, chromosome 5 at 124,637,595 bp
  • C to T, chromosome 5 at 137,835,417 bp
  • T to C, chromosome 6 at 42,435,097 bp
  • A to C, chromosome 6 at 145,815,247 bp
  • T to A, chromosome 7 at 8,908,117 bp
  • A to C, chromosome 7 at 12,606,491 bp
  • A to T, chromosome 7 at 27,364,336 bp
  • A to C, chromosome 7 at 29,185,482 bp
  • A to T, chromosome 7 at 30,731,924 bp
  • A to T, chromosome 7 at 62,378,382 bp
  • A to G, chromosome 9 at 22,250,515 bp
  • A to C, chromosome 10 at 49,419,696 bp
  • G to A, chromosome 10 at 61,300,155 bp
  • T to A, chromosome 10 at 63,002,993 bp
  • T to C, chromosome 10 at 88,091,380 bp
  • T to C, chromosome 11 at 11,802,842 bp
  • T to C, chromosome 11 at 75,658,693 bp
  • T to C, chromosome 11 at 87,401,450 bp
  • A to G, chromosome 11 at 95,265,290 bp
  • T to C, chromosome 11 at 96,345,780 bp
  • T to C, chromosome 11 at 103,616,893 bp
  • T to C, chromosome 11 at 120,729,802 bp
  • T to A, chromosome 12 at 10,375,472 bp
  • C to A, chromosome 12 at 38,630,593 bp
  • T to A, chromosome 12 at 40,725,649 bp
  • T to C, chromosome 12 at 86,691,840 bp
  • A to G, chromosome 14 at 32,805,172 bp
  • A to G, chromosome 14 at 52,778,923 bp
  • G to A, chromosome 14 at 53,757,898 bp
  • A to T, chromosome 15 at 83,308,151 bp
  • G to A, chromosome 15 at 99,722,086 bp
  • A to T, chromosome 16 at 21,766,390 bp
  • A to T, chromosome 16 at 59,558,873 bp
  • C to A, chromosome 16 at 87,718,848 bp
  • C to T, chromosome 17 at 24,550,276 bp
  • A to T, chromosome 18 at 32,090,515 bp
  • T to C, chromosome 18 at 42,560,935 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • T to C, chromosome 18 at 89,247,309 bp
  • A to T, chromosome 19 at 13,445,888 bp
  • G to A, chromosome 19 at 33,965,648 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7714 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045772-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.