Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7675Btlr/Mmmh
Stock Number:
045706-MU
Citation ID:
RRID:MMRRC_045706-MU
Other Names:
R7675 (G1)
Major Collection:

Strain Information

Casp8
Name: caspase 8
Synonyms: Mch5, MACH, FLICE, Caspase-8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12370
HGNC: HGNC:1509
Homologene: 7657
Ptpn23
Name: protein tyrosine phosphatase, non-receptor type 23
Synonyms: PTP-TD14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 104831
Homologene: 135706
Prpf40a
Name: pre-mRNA processing factor 40A
Synonyms: FBP11, 2810012K09Rik, Fnbp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56194
Homologene: 6377
Gucy2c
Name: guanylate cyclase 2c
Synonyms: GC-C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14917
HGNC: HGNC:4688
Homologene: 3641
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Zfp980
Name: zinc finger protein 980
Synonyms: Gm13242
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041379
Homologene: 133076
Lrrc8a
Name: leucine rich repeat containing 8A VRAC subunit A
Synonyms: Lrrc8, ebo, SWELL1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241296
Homologene: 18617
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67313
Homologene: 10103
Mideas
Name: mitotic deacetylase associated SANT domain protein
Synonyms: 9430029N19Rik, C130039O16Rik, Elmsan1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238317
Homologene: 19330
Nphp3
Name: nephronophthisis 3 (adolescent)
Synonyms: D330020E01Rik, pcy, nephrocystin 3, 3632410F03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74025
HGNC: HGNC:7907
Homologene: 32697
Clspn
Name: claspin
Synonyms: E130314M08Rik, C85083
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269582
Homologene: 11138
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Zbtb38
Name: zinc finger and BTB domain containing 38
Synonyms: A930014K01Rik, Zenon homolog, CIBZ
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245007
Homologene: 19529
Sp140l2
Name: Sp140 nuclear body protein like 2
Synonyms: OTTMUSG00000029174, C130026I21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 620078
Homologene: 131208
Tex14
Name: testis expressed gene 14 intercellular bridge forming factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83560
Homologene: 12838
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Krtap16-1
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100504183
Homologene: 99988
Serpinb9d
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9d
Synonyms: ovalbumin, Spi9, AT2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20726
HGNC: HGNC:8955
Homologene: 69093
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637053
Homologene: 129754
Calu
Name: calumenin
Synonyms: 9530075H20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12321
HGNC: HGNC:1458
Homologene: 936
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Spata31f3
Name: spermatogenesis associated 31 subfamily F member 3
Synonyms: BC049635, Fam205c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277773
Homologene: 77625
Eef2k
Name: eukaryotic elongation factor-2 kinase
Synonyms: eEF-2K
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13631
Homologene: 7299
Usp36
Name: ubiquitin specific peptidase 36
Synonyms: 2700002L06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72344
Homologene: 11828
Gm5519
Name: predicted pseudogene 5519
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433241
VEGA: 19
Sap30l
Name: SAP30-like
Synonyms: L55, 2310079P12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50724
Homologene: 11632
Tmsb10b
Name: thymosin beta 10b
Synonyms: Gm9844
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043712
Unc119
Name: unc-119 lipid binding chaperone
Synonyms: Rg4, HRG4, UNC119, Unc119h, MRG4, Rtg4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22248
Homologene: 3778
Naaladl2
Name: N-acetylated alpha-linked acidic dipeptidase-like 2
Synonyms: LOC381500, 2810043G22Rik, EG635702
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 635702
Homologene: 45786
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 58,823,947 bp
  • C to T, chromosome 1 at 85,247,015 bp
  • T to A, chromosome 1 at 136,110,874 bp
  • G to T, chromosome 1 at 136,216,003 bp
  • G to A, chromosome 2 at 30,255,668 bp
  • T to C, chromosome 2 at 53,145,636 bp
  • T to A, chromosome 3 at 24,551,652 bp
  • A to T, chromosome 3 at 64,415,236 bp
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp
  • T to C, chromosome 4 at 126,566,320 bp
  • C to T, chromosome 4 at 145,701,594 bp
  • T to C, chromosome 5 at 93,213,374 bp
  • C to T, chromosome 6 at 29,356,517 bp
  • A to G, chromosome 6 at 136,716,032 bp
  • A to T, chromosome 7 at 24,862,359 bp
  • A to G, chromosome 7 at 120,858,504 bp
  • G to T, chromosome 9 at 96,685,541 bp
  • A to T, chromosome 9 at 104,016,088 bp
  • A to T, chromosome 9 at 110,387,026 bp
  • A to G, chromosome 11 at 49,216,020 bp
  • A to G, chromosome 11 at 57,810,041 bp
  • G to A, chromosome 11 at 78,343,597 bp
  • A to G, chromosome 11 at 84,315,916 bp
  • A to G, chromosome 11 at 87,509,678 bp
  • A to G, chromosome 11 at 99,985,433 bp
  • A to G, chromosome 11 at 118,263,696 bp
  • G to T, chromosome 12 at 84,173,800 bp
  • A to T, chromosome 12 at 115,623,589 bp
  • C to T, chromosome 13 at 33,202,776 bp
  • A to T, chromosome 14 at 68,499,853 bp
  • T to C, chromosome 16 at 26,371,511 bp
  • G to C, chromosome 19 at 33,825,028 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7675 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045706-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.