Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7580Btlr/Mmmh
Stock Number:
045664-MU
Citation ID:
RRID:MMRRC_045664-MU
Other Names:
R7580 (G1)
Major Collection:

Strain Information

Mc1r
Name: melanocortin 1 receptor
Synonyms: e, Mshra, extension recessive yellow, Mcr1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17199
HGNC: HGNC:6929
Homologene: 1789
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Mtif3
Name: mitochondrial translational initiation factor 3
Synonyms: 2810012L14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76366
Homologene: 49927
Gtse1
Name: G two S phase expressed protein 1
Synonyms: B99, Gtse-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29870
VEGA: 15
Homologene: 8489
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53890
Homologene: 40977
Thoc1
Name: THO complex 1
Synonyms: 3110002N20Rik, NMP-84
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225160
VEGA: 18
Homologene: 38012
Tasor
Name: transcription activation suppressor
Synonyms: 4933409E02Rik, D14Abb1e, MommeD6, Fam208a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218850
VEGA: 14
Homologene: 9062
Mmp20
Name: matrix metallopeptidase 20 (enamelysin)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30800
VEGA: 9
HGNC: HGNC:7167
Homologene: 21001
Lrmda
Name: leucine rich melanocyte differentiation associated
Synonyms: Oca7, 1700112E06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76633
Homologene: 49975
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Bag1
Name: BCL2-associated athanogene 1
Synonyms: Rap46
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12017
HGNC: HGNC:937
Homologene: 3190
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Scaf4
Name: SR-related CTD-associated factor 4
Synonyms: Sra4, Sfrs15, Srsf15
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224432
VEGA: 16
Homologene: 16227
Adamtsl1
Name: ADAMTS-like 1
Synonyms: punctin-1, 6720426B09Rik, 5930437A14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77739
Homologene: 64642
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: 8030460J03Rik, BACH1, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Slc35d1
Name: solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
Synonyms: UGTREL7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242585
Homologene: 22870
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Gata3
Name: GATA binding protein 3
Synonyms: Gata-3, jal
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14462
HGNC: HGNC:4172
Homologene: 1550
Fmo2
Name: flavin containing monooxygenase 2
Synonyms: 2310008D08Rik, 2310042I22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 55990
HGNC: HGNC:3770
Homologene: 86882
Mppe1
Name: metallophosphoesterase 1
Synonyms: Pgap5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225651
VEGA: 18
Homologene: 41512
Kcnh6
Name: potassium voltage-gated channel, subfamily H (eag-related), member 6
Synonyms: m-erg2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192775
Homologene: 32740
Dglucy
Name: D-glutamate cyclase
Synonyms: 9030617O03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217830
Homologene: 11798
Cfap52
Name: cilia and flagella associated protein 52
Synonyms: 4933417B11Rik, 1700019F09Rik, Wdr16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71860
Homologene: 12416
4930486L24Rik
Name: RIKEN cDNA 4930486L24 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214639
VEGA: 13
Homologene: 138410
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Rap1gap
Name: Rap1 GTPase-activating protein
Synonyms: 2310004O14Rik, 1300019I11Rik, Rap1ga1, Gap
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110351
HGNC: HGNC:9858
Homologene: 2163
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Mvp
Name: major vault protein
Synonyms: VAULT1, LRP, 2310009M24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78388
HGNC: HGNC:7531
Homologene: 3752
Adamdec1
Name: ADAM-like, decysin 1
Synonyms: 2210414L24Rik, Dcsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58860
VEGA: 14
Homologene: 8711
Or2n1c
Name: olfactory receptor family 2 subfamily N member 1C
Synonyms: MOR256-48, GA_x6K02T2PSCP-2656648-2657586, Olfr135
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258329
Homologene: 110603
Kiz
Name: kizuna centrosomal protein
Synonyms: LOC228730, Ncrna00153, Gm114, Plk1s1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228730
Homologene: 10219
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23968
Homologene: 65105
Nmur2
Name: neuromedin U receptor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216749
Homologene: 49618
Hgd
Name: homogentisate 1, 2-dioxygenase
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15233
HGNC: HGNC:4892
Homologene: 156
Pira13
Name: paired-Ig-like receptor A13
Synonyms: ENSMUSG00000074419, Gm15448
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041146
Homologene: 134028
Ubl4b
Name: ubiquitin-like 4B
Synonyms: 4930522D07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67591
Homologene: 49855
Tas1r2
Name: taste receptor, type 1, member 2
Synonyms: TR2, T1r2, Gpr71
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83770
Homologene: 75323
Mmp28
Name: matrix metallopeptidase 28 (epilysin)
Synonyms: epilysin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 118453
Homologene: 41559
Endov
Name: endonuclease V
Synonyms: A730011L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338371
Homologene: 15562
Slc5a11
Name: solute carrier family 5 (sodium/glucose cotransporter), member 11
Synonyms: 2010013B02Rik, Kst1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233836
Homologene: 14184
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Mtss2
Name: MTSS I-BAR domain containing 2
Synonyms: ABBA, Mtss1l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244654
Homologene: 70926
Slc26a1
Name: solute carrier family 26 (sulfate transporter), member 1
Synonyms: Sat1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231583
Homologene: 32539
Ttll8
Name: tubulin tyrosine ligase-like family, member 8
Synonyms: 1700019P01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239591
Homologene: 52766
Purg
Name: purine-rich element binding protein G
Synonyms: 4930486B15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75029
Homologene: 22747
Cmtr2
Name: cap methyltransferase 2
Synonyms: C730036L12Rik, Ftsjd1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234728
Homologene: 10144
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 162,877,044 bp
  • A to C, chromosome 2 at 9,863,132 bp
  • T to C, chromosome 2 at 44,994,532 bp
  • C to G, chromosome 2 at 146,956,249 bp
  • G to A, chromosome 3 at 107,554,468 bp
  • C to T, chromosome 4 at 40,947,836 bp
  • T to A, chromosome 4 at 86,054,064 bp
  • C to A, chromosome 4 at 103,208,133 bp
  • T to C, chromosome 4 at 137,719,982 bp
  • G to A, chromosome 4 at 139,659,745 bp
  • T to A, chromosome 4 at 154,270,744 bp
  • A to G, chromosome 5 at 63,808,281 bp
  • A to G, chromosome 5 at 108,671,869 bp
  • A to T, chromosome 5 at 113,754,379 bp
  • T to G, chromosome 5 at 146,958,947 bp
  • A to T, chromosome 7 at 3,824,612 bp
  • T to C, chromosome 7 at 23,433,749 bp
  • C to T, chromosome 7 at 123,265,198 bp
  • T to C, chromosome 7 at 126,992,311 bp
  • G to A, chromosome 8 at 19,126,410 bp
  • A to G, chromosome 8 at 33,416,633 bp
  • T to A, chromosome 8 at 110,221,677 bp
  • G to A, chromosome 8 at 110,737,636 bp
  • G to T, chromosome 8 at 123,408,167 bp
  • C to T, chromosome 9 at 7,654,143 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • A to G, chromosome 9 at 96,011,679 bp
  • T to C, chromosome 9 at 110,436,050 bp
  • A to T, chromosome 10 at 86,869,164 bp
  • C to T, chromosome 11 at 56,026,982 bp
  • T to A, chromosome 11 at 67,946,320 bp
  • T to A, chromosome 11 at 83,444,832 bp
  • A to G, chromosome 11 at 86,157,601 bp
  • T to C, chromosome 11 at 106,017,548 bp
  • C to T, chromosome 11 at 119,499,866 bp
  • T to A, chromosome 12 at 55,718,228 bp
  • C to T, chromosome 12 at 100,850,164 bp
  • G to A, chromosome 13 at 3,574,752 bp
  • T to A, chromosome 13 at 38,022,724 bp
  • T to A, chromosome 13 at 60,845,226 bp
  • C to T, chromosome 14 at 22,019,857 bp
  • A to G, chromosome 14 at 27,466,286 bp
  • A to G, chromosome 14 at 68,565,531 bp
  • A to T, chromosome 15 at 58,558,396 bp
  • T to C, chromosome 15 at 73,556,447 bp
  • G to A, chromosome 15 at 85,862,231 bp
  • A to C, chromosome 15 at 88,933,929 bp
  • C to A, chromosome 16 at 37,618,879 bp
  • G to A, chromosome 16 at 90,229,852 bp
  • A to G, chromosome 17 at 30,775,103 bp
  • T to C, chromosome 17 at 38,209,043 bp
  • A to T, chromosome 18 at 9,986,343 bp
  • A to T, chromosome 18 at 20,050,073 bp
  • C to T, chromosome 18 at 67,237,417 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7580 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045664-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.