Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7568Btlr/Mmmh
Stock Number:
045630-MU
Citation ID:
RRID:MMRRC_045630-MU
Other Names:
R7568 (G1)
Major Collection:

Strain Information

Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Comp
Name: cartilage oligomeric matrix protein
Synonyms: thrombospondin-5, TSP5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12845
HGNC: HGNC:2227
Homologene: 74
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Baz2a
Name: bromodomain adjacent to zinc finger domain, 2A
Synonyms: Tip5, Walp3, C030005G16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 116848
VEGA: 10
HGNC: HGNC:962
Homologene: 8393
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, Def-5, 4930568E07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
F2rl1
Name: F2R like trypsin receptor 1
Synonyms: PAR-2, Par2, Protease-activated receptor-2, Gpcr11, proteinase-activated receptor-2, coagulation factor II (thrombin) receptor-like 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14063
VEGA: 13
HGNC: HGNC:3538
Homologene: 21087
Crebbp
Name: CREB binding protein
Synonyms: CBP, KAT3A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12914
HGNC: HGNC:2348
Homologene: 68393
Mlec
Name: malectin
Synonyms: ESTM19, 2410014A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109154
Homologene: 8823
Mavs
Name: mitochondrial antiviral signaling protein
Synonyms: IPS-1, D430028G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228607
Homologene: 17004
Atad2b
Name: ATPase family, AAA domain containing 2B
Synonyms: 1110014E10Rik, D530031C13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320817
VEGA: 12
Homologene: 86351
Dhtkd1
Name: dehydrogenase E1 and transketolase domain containing 1
Synonyms: C330018I04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209692
Homologene: 10278
Ssh1
Name: slingshot protein phosphatase 1
Synonyms: mSSH-1L, LOC384311
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231637
Homologene: 41299
Nfkbia
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha
Synonyms: I(Kappa)B(alpha), Nfkbi, I-kappaBalpha, IkappaBalpha
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18035
VEGA: 12
HGNC: HGNC:7797
Homologene: 7863
Ddr1
Name: discoidin domain receptor family, member 1
Synonyms: CD167a, Cak
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12305
HGNC: HGNC:2730
Homologene: 68212
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20850
Homologene: 20680
Siglec1
Name: sialic acid binding Ig-like lectin 1, sialoadhesin
Synonyms: CD169, Siglec-1, Sn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20612
Homologene: 124458
Fbxw16
Name: F-box and WD-40 domain protein 16
Synonyms: 7420402K12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320083
Homologene: 110776
Actl7a
Name: actin-like 7a
Synonyms: Tact2, t-actin 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11470
HGNC: HGNC:161
Homologene: 7613
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Slc39a12
Name: solute carrier family 39 (zinc transporter), member 12
Synonyms: LOC277468
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277468
Homologene: 17654
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM2SH2, SM25H2, Fbw10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213980
Homologene: 32757
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: B430315C20Rik, Hisppd2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Zfp959
Name: zinc finger protein 959
Synonyms: BC011426
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224893
Homologene: 138295
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Catip
Name: ciliogenesis associated TTC17 interacting protein
Synonyms: LOC241112, Gm216
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241112
Slc39a10
Name: solute carrier family 39 (zinc transporter), member 10
Synonyms: 2900042E17Rik, Zip10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227059
Homologene: 34076
Tex55
Name: testis expressed 55
Synonyms: 4930435E12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74663
Homologene: 17614
Alcam
Name: activated leukocyte cell adhesion molecule
Synonyms: DM-GRASP, CD166, MuSC, BEN, SC1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11658
HGNC: HGNC:400
Homologene: 1229
Krt23
Name: keratin 23
Synonyms: K23, CK23, Krt1-23
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94179
HGNC: HGNC:6438
Homologene: 9172
Vmn1r19
Name: vomeronasal 1 receptor 19
Synonyms: V1rc27
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171200
Homologene: 134034
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Best1
Name: bestrophin 1
Synonyms: best macular dystrophy, mBest1, Vmd2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24115
Homologene: 37895
Gabrg2
Name: gamma-aminobutyric acid type A receptor, subunit gamma 2
Synonyms: Gabrg-2, gamma2, GABAA-R
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14406
HGNC: HGNC:4087
Homologene: 22443
Pom121l2
Name: POM121 transmembrane nucleoporin like 2
Synonyms: LOC195236
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195236
Homologene: 123536
Fam136a
Name: family with sequence similarity 136, member A
Synonyms: 2010309E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66488
Homologene: 135942
Scrn2
Name: secernin 2
Synonyms: SES2, D11Moh48
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217140
Homologene: 26698
Or7a35
Name: olfactory receptor family 7 subfamily A member 35
Synonyms: GA_x6K02T2QGN0-2794907-2793948, MOR139-4, Olfr1351
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 259042
Homologene: 133668
Or12j2
Name: olfactory receptor family 12 subfamily J member 2
Synonyms: GA_x6K02T2PBJ9-42486061-42486978, MOR251-5, Olfr527
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257939
Homologene: 73958
Slc2a10
Name: solute carrier family 2 (facilitated glucose transporter), member 10
Synonyms: Glut10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170441
Homologene: 38551
Actbl2
Name: actin, beta-like 2
Synonyms: 4732495G21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238880
Homologene: 134276
Or8b43
Name: olfactory receptor family 8 subfamily B member 43
Synonyms: GA_x6K02T2PVTD-32141623-32142552, MOR169-1, Olfr902
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258798
VEGA: 9
Or12d14-ps1
Name: olfactory receptor family 12 subfamily D member 14, pseudogene 1
Synonyms: MOR250-5, GA_x6K02T2PSCP-1823235-1824161, Olfr104-ps, Olfr104
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257948
Sowahc
Name: sosondowah ankyrin repeat domain family member C
Synonyms: C820004L04Rik, Ankrd57
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268301
Homologene: 49723
Igkv19-93
Name: immunoglobulin kappa chain variable 19-93
Synonyms: Vx38C, Igk-V38
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692161
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 46,835,130 bp
  • G to T, chromosome 1 at 74,368,930 bp
  • A to T, chromosome 2 at 5,922,087 bp
  • T to A, chromosome 2 at 14,400,128 bp
  • T to C, chromosome 2 at 110,950,293 bp
  • A to T, chromosome 2 at 121,337,615 bp
  • C to T, chromosome 2 at 131,072,682 bp
  • A to G, chromosome 2 at 131,245,475 bp
  • A to G, chromosome 2 at 165,514,882 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • GTCACTGGTTCTGTGGTCACTGGTTCTGTG to GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG, chromosome 3 at 95,888,151 bp
  • GGTTCTGTGGTCACT to GGTTCTGTGGTCACTAGTTCTGTGGTCACT, chromosome 3 at 95,888,172 bp
  • A to T, chromosome 4 at 56,744,498 bp
  • T to C, chromosome 5 at 113,957,380 bp
  • T to C, chromosome 5 at 115,150,122 bp
  • A to G, chromosome 6 at 57,404,828 bp
  • G to A, chromosome 6 at 58,843,810 bp
  • T to A, chromosome 6 at 68,736,493 bp
  • A to G, chromosome 6 at 86,365,802 bp
  • T to G, chromosome 6 at 91,724,851 bp
  • A to G, chromosome 7 at 55,872,249 bp
  • A to G, chromosome 7 at 140,335,982 bp
  • A to G, chromosome 8 at 70,373,859 bp
  • A to G, chromosome 9 at 38,449,646 bp
  • C to A, chromosome 9 at 109,439,589 bp
  • A to G, chromosome 10 at 59,223,299 bp
  • A to T, chromosome 10 at 79,017,507 bp
  • T to C, chromosome 10 at 128,125,270 bp
  • T to C, chromosome 11 at 41,916,292 bp
  • C to A, chromosome 11 at 62,875,168 bp
  • T to C, chromosome 11 at 97,030,886 bp
  • T to A, chromosome 11 at 99,492,800 bp
  • T to C, chromosome 11 at 100,875,024 bp
  • A to G, chromosome 11 at 106,548,736 bp
  • T to A, chromosome 12 at 5,010,390 bp
  • A to G, chromosome 12 at 55,491,761 bp
  • A to T, chromosome 13 at 21,982,626 bp
  • G to A, chromosome 13 at 95,514,014 bp
  • T to A, chromosome 13 at 111,255,422 bp
  • C to A, chromosome 14 at 31,152,595 bp
  • G to A, chromosome 16 at 4,126,489 bp
  • T to C, chromosome 16 at 38,828,447 bp
  • A to G, chromosome 16 at 52,268,386 bp
  • C to A, chromosome 16 at 81,589,801 bp
  • A to G, chromosome 17 at 35,684,282 bp
  • A to G, chromosome 17 at 37,362,605 bp
  • A to T, chromosome 17 at 51,782,724 bp
  • A to G, chromosome 17 at 55,897,886 bp
  • T to A, chromosome 19 at 9,989,275 bp
  • T to C, chromosome 19 at 41,601,635 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7568 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045630-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.