Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7130Btlr/Mmmh
Stock Number:
045215-MU
Citation ID:
RRID:MMRRC_045215-MU
Other Names:
R7130 (G1)
Major Collection:

Strain Information

Npc2
Name: NPC intracellular cholesterol transporter 2
Synonyms: HE1, 2700012J19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67963
VEGA: 12
Homologene: 4697
Ppm1a
Name: protein phosphatase 1A, magnesium dependent, alpha isoform
Synonyms: Mpp alpha, MMPa-2, MPPa-1, 2900017D14Rik, 2310003C21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19042
VEGA: 12
HGNC: HGNC:9275
Homologene: 56428
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Cdk19
Name: cyclin dependent kinase 19
Synonyms: 2700084L06Rik, Cdc2l6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78334
VEGA: 10
Homologene: 22862
Sdf2
Name: stromal cell derived factor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20316
Homologene: 5045
Abtb3
Name: ankyrin repeat and BTB domain containing 3
Synonyms: 6330404E16Rik, Btbd11
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74007
Homologene: 72536
Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Fus
Name: fused in sarcoma
Synonyms: translocated in liposarcoma, Tls, hnRNP P2, pigpen, D930039C12Rik, D430004D17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233908
HGNC: HGNC:4010
Homologene: 134091
Tango6
Name: transport and golgi organization 6
Synonyms: Tmco7, Tango6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272538
Homologene: 52121
Slc38a2
Name: solute carrier family 38, member 2
Synonyms: 5033402L14Rik, SNAT2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67760
VEGA: 15
Homologene: 23132
Stip1
Name: stress-induced phosphoprotein 1
Synonyms: p60, IEF SSP 3521, Hop, Hsp70/Hsp90 organizing protein, STI1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20867
VEGA: 19
Homologene: 4965
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Islr2
Name: immunoglobulin superfamily containing leucine-rich repeat 2
Synonyms: B930052A04Rik, mbu-3, Linx
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320563
VEGA: 9
Homologene: 10833
Osbpl9
Name: oxysterol binding protein-like 9
Synonyms: 2600011I06Rik, ORP-9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100273
Homologene: 69380
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik, sao
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68750
Homologene: 2218
Nxpe2
Name: neurexophilin and PC-esterase domain family, member 2
Synonyms: 4432416J03Rik, Fam55b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78252
Homologene: 87072
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72017
Homologene: 96059
Sdccag8
Name: serologically defined colon cancer antigen 8
Synonyms: CCCAP, 2700048G21Rik, 5730470G24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76816
Homologene: 4839
Eif5b
Name: eukaryotic translation initiation factor 5B
Synonyms: IF2, A030003E17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226982
Homologene: 134613
Esyt3
Name: extended synaptotagmin-like protein 3
Synonyms: D9Ertd280e, Fam62c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272636
Homologene: 18626
Rhoh
Name: ras homolog family member H
Synonyms: 5830400A04Rik, Arhh
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74734
HGNC: HGNC:686
Homologene: 3180
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Pcdhb11
Name: protocadherin beta 11
Synonyms: Pcdhb5E, PcdhbK
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93882
HGNC: HGNC:8690
Homologene: 62178
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Vinac1
Name: vinculin/alpha-catenin family member 1
Synonyms: Gm14025
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668894
Homologene: 86340
Klkb1
Name: kallikrein B, plasma 1
Synonyms: Kal-3, Kal3, Klk3, PSA
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16621
HGNC: HGNC:6371
Homologene: 68097
Tdrd7
Name: tudor domain containing 7
Synonyms: 5730495N10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100121
Homologene: 8618
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240069
Homologene: 18615
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: Fbx12, E330009N23Rik, Fbxo12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50757
Homologene: 110776
Apbb1
Name: amyloid beta precursor protein binding family B member 1
Synonyms: Fe65, Rir
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11785
HGNC: HGNC:581
Homologene: 898
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Naaladl1
Name: N-acetylated alpha-linked acidic dipeptidase-like 1
Synonyms: LOC381204
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381204
Homologene: 21124
Pcnx2
Name: pecanex homolog 2
Synonyms: E330039K12Rik, Pcnxl2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Ubtfl1
Name: upstream binding transcription factor, RNA polymerase I-like 1
Synonyms: B020006M18Rik, Hmgpi
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546118
Homologene: 110115
Tmem143
Name: transmembrane protein 143
Synonyms: 2310076O21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70209
Homologene: 10105
Adcy6
Name: adenylate cyclase 6
Synonyms: AC6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11512
VEGA: 15
HGNC: HGNC:237
Homologene: 22400
Or2ag17
Name: olfactory receptor family 2 subfamily AG member 17
Synonyms: GA_x6K02T2PBJ9-9168355-9167405, MOR283-10P, Olfr699
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258180
Homologene: 79391
Bpifb9b
Name: BPI fold containing family B, member 9B
Synonyms: OTTMUSG00000015915, 5430413K10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433492
Homologene: 128535
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Tsga10
Name: testis specific 10
Synonyms: 4933432N21Rik, Mtsga10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211484
Homologene: 23531
Or4b1b
Name: olfactory receptor family 4 subfamily B member 1B
Synonyms: GA_x6K02T2Q125-51636504-51635578, MOR227-3, Olfr1272
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258982
HGNC: HGNC:8290
Homologene: 133649
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Slc40a1
Name: solute carrier family 40 (iron-regulated transporter), member 1
Synonyms: Ol5, ferroportin1, IREG1, FPN1, metal transporting protein 1, MTP1, Slc11a3, Dusg, Pcm
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53945
Homologene: 40959
Nlrx1
Name: NLR family member X1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270151
VEGA: 9
Homologene: 11623
Mrpl9
Name: mitochondrial ribosomal protein L9
Synonyms: C330013D18Rik, 8030480E20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78523
Homologene: 12696
Gucd1
Name: guanylyl cyclase domain containing 1
Synonyms: 1110038D17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68778
Homologene: 57149
Unc93a2
Name: unc-93 homolog A2
Synonyms: Gm9992
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 667055
VEGA: 17
Homologene: 10356
Kcnf1
Name: potassium voltage-gated channel, subfamily F, member 1
Synonyms: LOC382571
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382571
HGNC: HGNC:6246
Homologene: 124236
Thap3
Name: THAP domain containing, apoptosis associated protein 3
Synonyms: 2210418H06Rik, 2010013E08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69876
Homologene: 18413
Sftpb
Name: surfactant associated protein B
Synonyms: SF-B, SP-B, Sftp-3, Sftp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20388
Homologene: 456
Or9s27
Name: olfactory receptor family 9 subfamily S member 27
Synonyms: GA_x6K02T2R7CC-81165686-81164721, MOR208-4, Olfr1412
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258274
Homologene: 115514
Umad1
Name: UMAP1-MVP12 associated (UMA) domain containing 1
Synonyms: Gm16039
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100036521
Or2w1
Name: olfactory receptor family 2 subfamily W member 1
Synonyms: IA3, GA_x6K02T2N5E5-9379-8514, MOR256-31, GA_x6K02T2QHY8-12114828-12113875, MOR256-37P, MOR256-61, Olfr42, Olfr263-ps1, Olfr263
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18341
HGNC: HGNC:8281
Homologene: 12791
Lrrc78
Name: leucine rich repeat containing 78
Synonyms: Gm28729
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102635744
Homologene: 139355
Spopfm3
Name: speckle-type BTB/POZ protein family member 3
Synonyms: Gm5286
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 383977
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 37,783,884 bp
  • A to G, chromosome 1 at 38,041,776 bp
  • A to T, chromosome 1 at 45,921,224 bp
  • C to T, chromosome 1 at 92,588,912 bp
  • T to G, chromosome 1 at 134,408,021 bp
  • T to A, chromosome 1 at 165,504,047 bp
  • C to A, chromosome 1 at 176,874,601 bp
  • C to T, chromosome 1 at 181,745,958 bp
  • T to C, chromosome 2 at 76,890,669 bp
  • T to C, chromosome 2 at 90,281,922 bp
  • A to T, chromosome 2 at 129,039,181 bp
  • T to A, chromosome 2 at 154,311,672 bp
  • T to A, chromosome 3 at 38,980,787 bp
  • T to C, chromosome 3 at 94,198,527 bp
  • A to G, chromosome 3 at 94,447,290 bp
  • T to C, chromosome 4 at 46,029,693 bp
  • G to A, chromosome 4 at 109,083,099 bp
  • T to C, chromosome 4 at 151,988,916 bp
  • C to T, chromosome 5 at 14,679,342 bp
  • T to C, chromosome 5 at 65,892,864 bp
  • T to C, chromosome 5 at 76,149,837 bp
  • G to T, chromosome 6 at 8,427,185 bp
  • T to A, chromosome 6 at 72,305,824 bp
  • T to A, chromosome 7 at 45,909,477 bp
  • T to C, chromosome 7 at 87,002,266 bp
  • G to A, chromosome 7 at 105,565,331 bp
  • A to G, chromosome 7 at 106,790,182 bp
  • G to A, chromosome 7 at 127,974,413 bp
  • T to A, chromosome 8 at 45,275,538 bp
  • A to G, chromosome 8 at 106,807,101 bp
  • G to A, chromosome 8 at 125,753,584 bp
  • C to A, chromosome 8 at 127,415,683 bp
  • C to A, chromosome 9 at 18,409,847 bp
  • T to C, chromosome 9 at 44,262,341 bp
  • T to C, chromosome 9 at 48,339,537 bp
  • T to A, chromosome 9 at 51,849,747 bp
  • T to C, chromosome 9 at 58,198,292 bp
  • T to G, chromosome 9 at 96,519,404 bp
  • T to A, chromosome 9 at 99,318,170 bp
  • T to A, chromosome 9 at 109,271,282 bp
  • A to G, chromosome 10 at 40,479,765 bp
  • A to T, chromosome 10 at 51,678,380 bp
  • A to G, chromosome 10 at 75,512,117 bp
  • A to C, chromosome 10 at 85,387,555 bp
  • T to C, chromosome 11 at 78,245,997 bp
  • T to C, chromosome 12 at 17,175,809 bp
  • T to A, chromosome 12 at 72,784,233 bp
  • A to G, chromosome 12 at 84,765,307 bp
  • T to C, chromosome 13 at 3,548,891 bp
  • T to G, chromosome 13 at 21,133,246 bp
  • T to C, chromosome 13 at 37,899,748 bp
  • C to T, chromosome 13 at 77,269,902 bp
  • TACCTTGTTACTGAGCCCTTCTCACCTTCACAGACACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC to TACCTTGTTACTGAGCCCTTCTCACCTTCACAGATACCTTGTTACTGAGCCCTTCTC, chromosome 15 at 27,742,313 bp
  • G to T, chromosome 15 at 96,691,382 bp
  • A to G, chromosome 15 at 98,597,229 bp
  • T to A, chromosome 16 at 50,210,442 bp
  • T to C, chromosome 17 at 7,370,425 bp
  • T to A, chromosome 17 at 33,136,288 bp
  • A to G, chromosome 18 at 37,423,506 bp
  • G to A, chromosome 18 at 37,485,445 bp
  • C to T, chromosome 18 at 61,132,378 bp
  • A to G, chromosome 19 at 6,105,988 bp
  • C to T, chromosome 19 at 7,021,810 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7130 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045215-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.