Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7115Btlr/Mmmh
Stock Number:
045206-MU
Citation ID:
RRID:MMRRC_045206-MU
Other Names:
R7115 (G1)
Major Collection:

Strain Information

Eomes
Name: eomesodermin
Synonyms: Tbr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13813
HGNC: HGNC:3372
Homologene: 3971
Tfr2
Name: transferrin receptor 2
Synonyms: Tfr2, Trfr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50765
Homologene: 2428
Ranbp9
Name: RAN binding protein 9
Synonyms: IBAP-1, RanBPM
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56705
VEGA: 13
Homologene: 38057
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Cfap20
Name: cilia and flagella associated protein 20
Synonyms: T10-2A2, 2600014O15Rik, Gtl3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14894
Homologene: 7350
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Ap5m1
Name: adaptor-related protein complex 5, mu 1 subunit
Synonyms: 4932432K03Rik, Mudeng
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74385
VEGA: 14
Homologene: 10081
Pxylp1
Name: 2-phosphoxylose phosphatase 1
Synonyms: C130099A20Rik, 9430094M07Rik, Acpl2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235534
Homologene: 15931
Dnajb2
Name: DnaJ heat shock protein family (Hsp40) member B2
Synonyms: mDj8, 2700059H22Rik, Dnajb10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56812
HGNC: HGNC:5228
Homologene: 4902
Dennd2a
Name: DENN domain containing 2A
Synonyms: B930096L08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209773
Homologene: 35238
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Elf3
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Dennd5a
Name: DENN domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19347
Homologene: 14584
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Csn1s2a
Name: casein alpha s2-like A
Synonyms: Csn1s2a, Csng
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12993
Homologene: 7284
Axdnd1
Name: axonemal dynein light chain domain containing 1
Synonyms: LOC381304, 9430070O13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77352
Homologene: 52328
Apcdd1
Name: adenomatosis polyposis coli down-regulated 1
Synonyms: EIG180, Drapc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 494504
VEGA: 18
Homologene: 77420
Or8g20
Name: olfactory receptor family 8 subfamily G member 20
Synonyms: IB3, MOR171-5, GA_x6K02T2PVTD-33181773-33180838, Olfr44
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18343
VEGA: 9
HGNC: HGNC:8484
Homologene: 133633
Spice1
Name: spindle and centriole associated protein 1
Synonyms: D16Ertd480e, Ccdc52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212514
Homologene: 16931
Ctif
Name: CBP80/20-dependent translation initiation factor
Synonyms: LOC269037, Gm672
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269037
VEGA: 18
Homologene: 56682
Abcc1
Name: ATP-binding cassette, sub-family C member 1
Synonyms: MRP, Mdrap, Mrp1, Abcc1b, Abcc1a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Tas2r131
Name: taste receptor, type 2, member 131
Synonyms: mGR31, Tas2r31, mt2r61, T2R31
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387356
Homologene: 52298
Map2k1
Name: mitogen-activated protein kinase kinase 1
Synonyms: MAP kinase kinase 1, Prkmk1, Mek1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26395
HGNC: HGNC:6840
Homologene: 2063
Carf
Name: calcium response factor
Synonyms: Als2cr8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241066
Homologene: 11689
Rassf5
Name: Ras association (RalGDS/AF-6) domain family member 5
Synonyms: 1300019G20Rik, Nore1B, Nore1A, Rapl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54354
Homologene: 10296
Gm10428
Name: predicted gene 10428
Type: Gene
Species: Mouse
Chromosome: 11
Trim56
Name: tripartite motif-containing 56
Synonyms: LOC384309, RNF109, A130009K11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384309
Homologene: 12812
Gpt2
Name: glutamic pyruvate transaminase (alanine aminotransferase) 2
Synonyms: ALT2, 4631422C05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108682
Homologene: 68832
Vmn2r44
Name: vomeronasal 2, receptor 44
Synonyms: EG434113
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434113
Homologene: 113703
Ccdc103
Name: coiled-coil domain containing 103
Synonyms: 1700039D13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73293
Homologene: 45831
Ring1
Name: ring finger protein 1
Synonyms: Ring1A
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19763
Homologene: 68283
Amd2
Name: S-adenosylmethionine decarboxylase 2
Synonyms: Amd3, ENSMUSG00000063953
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041585
VEGA: 10
HGNC: HGNC:457
Homologene: 1235
Or10n7
Name: olfactory receptor family 10 subfamily N member 7
Synonyms: GA_x6K02T2PVTD-33383715-33382802, MOR224-1, Or10n7-ps1, Olfr964-ps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258855
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 60,148,150 bp
  • G to A, chromosome 1 at 75,243,662 bp
  • A to G, chromosome 1 at 131,181,249 bp
  • T to G, chromosome 1 at 135,257,118 bp
  • T to C, chromosome 1 at 156,380,876 bp
  • A to T, chromosome 1 at 181,720,145 bp
  • T to A, chromosome 2 at 40,998,235 bp
  • G to A, chromosome 2 at 66,324,618 bp
  • T to C, chromosome 5 at 87,781,805 bp
  • T to A, chromosome 5 at 137,113,660 bp
  • A to G, chromosome 5 at 137,571,715 bp
  • A to T, chromosome 5 at 150,386,067 bp
  • G to A, chromosome 6 at 39,506,711 bp
  • A to G, chromosome 6 at 132,957,604 bp
  • T to A, chromosome 7 at 8,367,528 bp
  • A to G, chromosome 7 at 109,894,754 bp
  • A to G, chromosome 8 at 24,781,696 bp
  • G to A, chromosome 8 at 85,518,052 bp
  • T to C, chromosome 8 at 95,421,246 bp
  • T to C, chromosome 9 at 39,484,648 bp
  • T to C, chromosome 9 at 39,686,707 bp
  • A to G, chromosome 9 at 64,212,606 bp
  • G to A, chromosome 9 at 96,825,010 bp
  • A to G, chromosome 9 at 118,484,489 bp
  • C to A, chromosome 10 at 35,711,637 bp
  • T to A, chromosome 10 at 77,836,299 bp
  • G to A, chromosome 11 at 36,163,817 bp
  • G to A, chromosome 11 at 62,753,380 bp
  • A to T, chromosome 11 at 102,883,810 bp
  • T to C, chromosome 13 at 43,406,671 bp
  • T to G, chromosome 13 at 113,320,776 bp
  • T to A, chromosome 14 at 49,086,270 bp
  • T to A, chromosome 16 at 14,437,725 bp
  • G to A, chromosome 16 at 44,379,275 bp
  • A to G, chromosome 17 at 34,023,446 bp
  • T to C, chromosome 18 at 62,936,953 bp
  • CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC, chromosome 18 at 75,471,803 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7115 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045206-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.