Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7111Btlr/Mmmh
Stock Number:
045203-MU
Citation ID:
RRID:MMRRC_045203-MU
Other Names:
R7111 (G1)
Major Collection:

Strain Information

Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Armc9
Name: armadillo repeat containing 9
Synonyms: 5730415N24Rik, 3830422A13Rik, 4831423D23Rik, 4930438O05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78795
Homologene: 11847
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: nucling, 2700059D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57752
Homologene: 5087
Stip1
Name: stress-induced phosphoprotein 1
Synonyms: p60, IEF SSP 3521, Hop, Hsp70/Hsp90 organizing protein, STI1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20867
VEGA: 19
Homologene: 4965
Wrap53
Name: WD repeat containing, antisense to Trp53
Synonyms: Wdr79
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216853
Homologene: 9995
Zfp866
Name: zinc finger protein 866
Synonyms: 9830167H18Rik, D330038O06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330788
Rcn1
Name: reticulocalbin 1
Synonyms: Rcn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19672
HGNC: HGNC:9934
Homologene: 20637
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
Sqstm1
Name: sequestosome 1
Synonyms: A170, OSF-6, STAP, Osi, p62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18412
Homologene: 31202
Grk6
Name: G protein-coupled receptor kinase 6
Synonyms: Gprk6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26385
VEGA: 13
HGNC: HGNC:4545
Homologene: 37570
Fam13c
Name: family with sequence similarity 13, member C
Synonyms: C030038O19Rik, 1200015N20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71721
Homologene: 11490
Ccdc171
Name: coiled-coil domain containing 171
Synonyms: 4930418J05Rik, A330015D16Rik, 4930473A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320226
Homologene: 27942
Agap3
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 3
Synonyms: MRIP-1, Crag, Centg3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213990
Homologene: 23742
Styxl2
Name: serine/threonine/tyrosine interacting like 2
Synonyms: C130085G02Rik, Dusp27
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240892
Homologene: 18949
Siglece
Name: sialic acid binding Ig-like lectin E
Synonyms: mSiglec-E, Siglecl1, Siglec5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83382
Homologene: 130669
Umod
Name: uromodulin
Synonyms: Tamm-Horsfall glycoprotein, uromucoid, urehr4, Urehd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22242
Homologene: 2522
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Itga2
Name: integrin alpha 2
Synonyms: VLA-2 receptor, alpha 2 subunit, CD49B, DX5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16398
VEGA: 13
HGNC: HGNC:6137
Homologene: 1662
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Casp1
Name: caspase 1
Synonyms: ICE, Caspase-1, interleukin 1 beta-converting enzyme, Il1bc
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12362
VEGA: 9
HGNC: HGNC:1499
Homologene: 133272
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Dnai3
Name: dynein axonemal intermediate chain 3
Synonyms: 4931433A13Rik, IC140, Ida7, Wdr63
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242253
Homologene: 44922
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Iqch
Name: IQ motif containing H
Synonyms: 4921504K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78250
Homologene: 11258
Mx1
Name: MX dynamin-like GTPase 1
Synonyms: myxovirus (influenza) resistance 1 polypeptide, Mx-1, Mx
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17857
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Ephb3
Name: Eph receptor B3
Synonyms: Sek4, MDK5, HEK2, Etk2, Tyro6, Cek10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13845
HGNC: HGNC:3394
Homologene: 20938
Cdh7
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Aldh9a1
Name: aldehyde dehydrogenase 9, subfamily A1
Synonyms: TMABA-DH, ESTM40
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56752
HGNC: HGNC:412
Homologene: 55483
Serpina3j
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3J
Synonyms: alpha-1 antiproteinase, Gm4931
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238395
HGNC: HGNC:16
Homologene: 120222
Mfsd6
Name: major facilitator superfamily domain containing 6
Synonyms: 9630025I22Rik, MMR2, 2210010L05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98682
Homologene: 9784
Krt86
Name: keratin 86
Synonyms: MHb4, Krt2-11, Khb4, Krt2-10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16679
VEGA: 15
HGNC: HGNC:6463
Homologene: 1717
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Cd79b
Name: CD79B antigen
Synonyms: B29, Igb, Igbeta, Ig-beta
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15985
HGNC: HGNC:1699
Homologene: 521
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Tspan9
Name: tetraspanin 9
Synonyms: 6720474K14Rik, 9430079M16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109246
Homologene: 4860
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Ablim1
Name: actin-binding LIM protein 1
Synonyms: Limab1, abLIM-S, abLIM-M, abLIM-L, 4833406P10Rik, 2610209L21Rik, 9330196J19Rik, 2210411C18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226251
HGNC: HGNC:78
Homologene: 40994
Or10p1
Name: olfactory receptor family 10 subfamily P member 1
Synonyms: GA_x6K02T2PULF-11287099-11286167, MOR269-1, Olfr796
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258933
Homologene: 17439
Tnfrsf18
Name: tumor necrosis factor receptor superfamily, member 18
Synonyms: Gitr
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21936
Homologene: 48270
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Serpinb11
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 11
Synonyms: 2310046M08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66957
Homologene: 41653
Arhgef26
Name: Rho guanine nucleotide exchange factor 26
Synonyms: 8430436L14Rik, 4631416L12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 622434
Homologene: 9204
Nme8
Name: NME/NM23 family member 8
Synonyms: 1700056P15Rik, Sptrx-2, Txndc3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73412
Homologene: 9593
Pdlim3
Name: PDZ and LIM domain 3
Synonyms: ALP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 53318
Homologene: 75063
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Sema4c
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms: M-Sema F, Semaf, Semacl1, Semai, Semacl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20353
Homologene: 23047
Cdca7
Name: cell division cycle associated 7
Synonyms: JPO1, 2310021G01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66953
Homologene: 49970
Cxcl1
Name: C-X-C motif chemokine ligand 1
Synonyms: N51, Mgsa, Fsp, Scyb1, Gro1, KC/GRO-alpha, KC
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14825
Homologene: 105490
Or5d36
Name: olfactory receptor family 5 subfamily D member 36
Synonyms: GA_x6K02T2Q125-49563265-49562315, MOR174-8, Olfr1163
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258638
Homologene: 17328
Vmn2r31
Name: vomeronasal 2, receptor 31
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042591
Homologene: 113703
Cdkn1c
Name: cyclin dependent kinase inhibitor 1C
Synonyms: Kip2, p57Kip2, CDKI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12577
HGNC: HGNC:1786
Homologene: 134519
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 36,553,079 bp
  • G to T, chromosome 1 at 52,709,758 bp
  • T to C, chromosome 1 at 86,159,995 bp
  • A to G, chromosome 1 at 107,376,884 bp
  • T to C, chromosome 1 at 110,137,908 bp
  • T to A, chromosome 1 at 158,956,526 bp
  • T to C, chromosome 1 at 166,127,154 bp
  • T to A, chromosome 1 at 167,354,452 bp
  • G to A, chromosome 2 at 72,485,231 bp
  • G to A, chromosome 2 at 88,070,656 bp
  • G to A, chromosome 2 at 91,607,572 bp
  • T to C, chromosome 2 at 105,389,014 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 39,010,533 bp
  • T to A, chromosome 3 at 62,345,268 bp
  • T to C, chromosome 3 at 146,097,273 bp
  • A to T, chromosome 4 at 58,118,207 bp
  • A to G, chromosome 4 at 83,693,761 bp
  • G to C, chromosome 4 at 120,095,234 bp
  • T to A, chromosome 4 at 156,028,711 bp
  • A to G, chromosome 5 at 24,501,398 bp
  • A to G, chromosome 5 at 41,813,120 bp
  • G to T, chromosome 5 at 67,025,176 bp
  • A to G, chromosome 5 at 90,891,323 bp
  • T to C, chromosome 6 at 127,965,763 bp
  • A to T, chromosome 6 at 146,325,056 bp
  • A to G, chromosome 7 at 7,396,481 bp
  • T to C, chromosome 7 at 43,659,903 bp
  • G to T, chromosome 7 at 119,477,146 bp
  • G to A, chromosome 7 at 130,728,888 bp
  • T to C, chromosome 7 at 143,460,589 bp
  • A to G, chromosome 7 at 144,411,552 bp
  • A to G, chromosome 8 at 45,917,502 bp
  • A to T, chromosome 8 at 69,766,571 bp
  • A to T, chromosome 9 at 5,299,816 bp
  • C to T, chromosome 9 at 60,871,838 bp
  • T to A, chromosome 9 at 63,512,317 bp
  • T to C, chromosome 10 at 52,181,810 bp
  • T to A, chromosome 10 at 60,387,044 bp
  • T to A, chromosome 10 at 70,554,506 bp
  • C to T, chromosome 10 at 79,378,771 bp
  • T to A, chromosome 10 at 129,607,960 bp
  • G to T, chromosome 11 at 50,202,591 bp
  • A to C, chromosome 11 at 69,446,753 bp
  • A to T, chromosome 11 at 69,562,479 bp
  • T to C, chromosome 11 at 106,314,539 bp
  • T to A, chromosome 12 at 104,317,533 bp
  • G to A, chromosome 13 at 19,675,647 bp
  • G to T, chromosome 13 at 55,458,920 bp
  • T to C, chromosome 13 at 114,900,530 bp
  • A to T, chromosome 15 at 101,476,617 bp
  • A to T, chromosome 16 at 21,218,827 bp
  • A to G, chromosome 16 at 97,455,176 bp
  • C to T, chromosome 19 at 7,021,810 bp
  • T to G, chromosome 19 at 57,073,877 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7111 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045203-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.