Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7017Btlr/Mmmh
Stock Number:
045118-MU
Citation ID:
RRID:MMRRC_045118-MU
Other Names:
R7017 (G1)
Major Collection:

Strain Information

St8sia1
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms: alpha-2,8-sialyltransferase, ST8Sia I, GD3S, GD3 synthase, Siat8, Siat8a, 9330109E03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20449
Homologene: 2282
Drd2
Name: dopamine receptor D2
Synonyms: D2 receptor, D2R, Drd-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13489
VEGA: 9
HGNC: HGNC:3023
Homologene: 22561
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Kera
Name: keratocan
Synonyms: SLRR2B, CNA2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16545
VEGA: 10
HGNC: HGNC:6309
Homologene: 5106
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Thbs3
Name: thrombospondin 3
Synonyms: Thbs-3, TSP3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21827
Homologene: 5159
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98999
Homologene: 10877
Pogz
Name: pogo transposable element with ZNF domain
Synonyms: 9530006B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229584
Homologene: 9022
Ddx4
Name: DEAD box helicase 4
Synonyms: mvh / m'vasa, VASA, Mvh, DEAD (Asp-Glu-Ala-Asp) box polypeptide 4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13206
VEGA: 13
Homologene: 49227
Ralgapb
Name: Ral GTPase activating protein, beta subunit (non-catalytic)
Synonyms: B230339M05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228850
Homologene: 10666
Plcg1
Name: phospholipase C, gamma 1
Synonyms: Plc-1, Plcg-1, Plc-gamma1, Cded
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18803
HGNC: HGNC:9065
Homologene: 1997
Gnpat
Name: glyceronephosphate O-acyltransferase
Synonyms: D1Ertd819e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14712
HGNC: HGNC:4416
Homologene: 40716
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Srf
Name: serum response factor
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20807
VEGA: 17
Homologene: 31135
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Mpzl2
Name: myelin protein zero-like 2
Synonyms: Eva1, Eva
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14012
HGNC: HGNC:3496
Homologene: 7309
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: CD140b, Pdgfr
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Tgfbr1
Name: transforming growth factor, beta receptor I
Synonyms: TbetaR-I, TbetaRI, ALK5, Alk-5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21812
Homologene: 3177
Kif3b
Name: kinesin family member 3B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16569
HGNC: HGNC:6320
Homologene: 55849
Hbp1
Name: high mobility group box transcription factor 1
Synonyms: 1700058O05Rik, C330012F01Rik, C86454
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73389
Homologene: 8171
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Dnah12
Name: dynein, axonemal, heavy chain 12
Synonyms: Hdhc3, HL-19, DLP12, HL19, DHC3, LOC380889, 4921531P07Rik, Dnahc7l, Dnahc12
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110083
HGNC: HGNC:2943
Homologene: 56821
Dgkg
Name: diacylglycerol kinase, gamma
Synonyms: Dagk3, E430001K23Rik, 2900055E17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110197
HGNC: HGNC:2853
Homologene: 1029
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Pdzd8
Name: PDZ domain containing 8
Synonyms: A630041P07Rik, Pdzk8
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Plek
Name: pleckstrin
Synonyms: 2010300B13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56193
HGNC: HGNC:9070
Homologene: 2000
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Ptchd4
Name: patched domain containing 4
Synonyms: 3110082D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627626
VEGA: 17
Homologene: 78322
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Ephx4
Name: epoxide hydrolase 4
Synonyms: LOC384214, Abhd7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384214
Homologene: 62402
Scamp1
Name: secretory carrier membrane protein 1
Synonyms: 4930505M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107767
Homologene: 37975
Cacna1i
Name: calcium channel, voltage-dependent, alpha 1I subunit
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239556
HGNC: HGNC:1396
Homologene: 69331
Tas2r123
Name: taste receptor, type 2, member 123
Synonyms: T2R23, Tas2r23, STC 9-2, mGR23, mt2r55
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353167
Homologene: 45450
Cyp2d40
Name: cytochrome P450, family 2, subfamily d, polypeptide 40
Synonyms: 1300013D18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71754
VEGA: 15
Homologene: 135470
Kcnma1
Name: potassium large conductance calcium-activated channel, subfamily M, alpha member 1
Synonyms: Slo, mSlo1, Slo1, MaxiK, BK channel alpha subunit, 5730414M22Rik, BKCa
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16531
HGNC: HGNC:6284
Homologene: 1693
Rdh1
Name: retinol dehydrogenase 1 (all trans)
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 107605
Homologene: 129514
Lrrc15
Name: leucine rich repeat containing 15
Synonyms: 5430427N11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74488
Homologene: 26080
Mrgprb2
Name: MAS-related GPR, member B2
Synonyms: 4833406I20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243979
Homologene: 86246
Mybphl
Name: myosin binding protein H-like
Synonyms: 1110037P11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68753
Homologene: 19221
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Lilra6
Name: leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
Synonyms: 7M1, Pira3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18726
Homologene: 134028
Gpx5
Name: glutathione peroxidase 5
Synonyms: Arep
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14780
HGNC: HGNC:4557
Homologene: 1155
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: protein-glutamine-gamma-glutamyltransferase, K polypeptide, TG K, TGase 1, 2310004J08Rik, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Rimbp3
Name: RIMS binding protein 3
Synonyms: LOC239731, LOC385766, RIM-BP3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239731
Homologene: 77940
Fpr1
Name: formyl peptide receptor 1
Synonyms: FPR, fMLF-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14293
HGNC: HGNC:3826
Homologene: 20466
Lvrn
Name: laeverin
Synonyms: 4833403I15Rik, Aqpep
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74574
VEGA: 18
Homologene: 51352
Fbxl12
Name: F-box and leucine-rich repeat protein 12
Synonyms: 3110048D16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 30843
Homologene: 32198
Tent5b
Name: terminal nucleotidyltransferase 5B
Synonyms: 4732473B16Rik, Fam46b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100342
Homologene: 24928
Lrrc34
Name: leucine rich repeat containing 34
Synonyms: 1700007J06Rik, Spata34
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71827
Homologene: 27419
Psg22
Name: pregnancy-specific beta-1-glycoprotein 22
Synonyms: cea9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243862
HGNC: HGNC:1816
Homologene: 110989
Gask1a
Name: golgi associated kinase 1A
Synonyms: C730027P07Rik, Fam198a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245050
VEGA: 9
Homologene: 18620
Tpra1
Name: transmembrane protein, adipocyte asscociated 1
Synonyms: Tpra40, 40kDa, Gpr175
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 24100
Homologene: 40799
Fbxo40
Name: F-box protein 40
Synonyms: 9830003A13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207215
Homologene: 9459
Acot3
Name: acyl-CoA thioesterase 3
Synonyms: PTE-Ia, Pte2a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 171281
Homologene: 134585
Pdzd9
Name: PDZ domain containing 9
Synonyms: 4930408O21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67983
Homologene: 27865
Orm1
Name: orosomucoid 1
Synonyms: Agp-2, Agp-1, Orm-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18405
Homologene: 130632
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Cd5l
Name: CD5 antigen-like
Synonyms: AAC-11, AIM/Spalpha, Sp-alpha, Pdp 1/6, Api6, AIM
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11801
HGNC: HGNC:1690
Homologene: 55936
Syt12
Name: synaptotagmin XII
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 171180
Homologene: 15895
S100a14
Name: S100 calcium binding protein A14
Synonyms: 1110013O05Rik, S100a15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66166
Homologene: 10781
Slc30a2
Name: solute carrier family 30 (zinc transporter), member 2
Synonyms: Znt2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230810
Homologene: 40855
St6galnac5
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Synonyms: ST6GalNAc V, Siat7e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26938
Homologene: 8079
Or5g23
Name: olfactory receptor family 5 subfamily G member 23
Synonyms: GA_x6K02T2Q125-47087719-47086775, MOR175-9, Olfr1000
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257899
Fabp9
Name: fatty acid binding protein 9, testis
Synonyms: Tlbp, 1700007P10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 21884
HGNC: HGNC:3563
Homologene: 40776
Ighv1-36
Name: immunoglobulin heavy variable 1-36
Synonyms: Gm16715
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629897
Gm7945
Name: predicted gene 7945
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 102634872
Homologene: 128452
Iqcf5
Name: IQ motif containing F5
Synonyms: 1700007L12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75470
Homologene: 20043
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 126,102,661 bp
  • T to C, chromosome 1 at 136,095,858 bp
  • T to A, chromosome 2 at 85,608,329 bp
  • T to A, chromosome 2 at 153,329,724 bp
  • C to A, chromosome 2 at 158,448,337 bp
  • A to T, chromosome 2 at 160,758,097 bp
  • T to C, chromosome 2 at 167,048,534 bp
  • C to G, chromosome 2 at 180,976,304 bp
  • C to A, chromosome 3 at 10,194,696 bp
  • C to T, chromosome 3 at 30,645,316 bp
  • G to A, chromosome 3 at 38,891,543 bp
  • T to C, chromosome 3 at 53,519,602 bp
  • C to A, chromosome 3 at 87,366,061 bp
  • A to T, chromosome 3 at 89,224,415 bp
  • T to C, chromosome 3 at 90,527,295 bp
  • T to C, chromosome 3 at 94,854,024 bp
  • T to A, chromosome 3 at 108,374,838 bp
  • T to C, chromosome 3 at 152,846,403 bp
  • T to C, chromosome 4 at 19,623,124 bp
  • T to A, chromosome 4 at 45,940,934 bp
  • T to C, chromosome 4 at 47,410,728 bp
  • T to A, chromosome 4 at 63,345,211 bp
  • T to C, chromosome 4 at 133,486,234 bp
  • G to A, chromosome 4 at 134,347,415 bp
  • T to A, chromosome 4 at 139,393,090 bp
  • GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GAGACAACGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,948 bp
  • T to C, chromosome 5 at 107,406,114 bp
  • T to A, chromosome 6 at 17,491,287 bp
  • T to A, chromosome 6 at 88,908,312 bp
  • A to G, chromosome 6 at 132,847,550 bp
  • C to A, chromosome 6 at 142,867,906 bp
  • G to T, chromosome 7 at 3,908,708 bp
  • C to A, chromosome 7 at 18,724,441 bp
  • A to T, chromosome 7 at 45,358,800 bp
  • T to A, chromosome 7 at 48,552,837 bp
  • T to A, chromosome 7 at 120,663,002 bp
  • G to C, chromosome 7 at 141,809,687 bp
  • T to C, chromosome 8 at 124,863,275 bp
  • A to G, chromosome 9 at 20,618,320 bp
  • G to T, chromosome 9 at 45,047,289 bp
  • G to A, chromosome 9 at 49,400,829 bp
  • T to A, chromosome 9 at 106,515,664 bp
  • T to C, chromosome 9 at 121,965,986 bp
  • A to T, chromosome 10 at 97,609,077 bp
  • A to G, chromosome 10 at 127,763,037 bp
  • G to A, chromosome 11 at 17,052,220 bp
  • T to A, chromosome 11 at 36,171,409 bp
  • T to A, chromosome 11 at 69,491,547 bp
  • A to G, chromosome 11 at 105,923,108 bp
  • A to G, chromosome 12 at 31,943,853 bp
  • A to T, chromosome 12 at 84,053,303 bp
  • T to A, chromosome 12 at 114,879,913 bp
  • G to A, chromosome 13 at 21,291,391 bp
  • A to G, chromosome 13 at 38,186,707 bp
  • T to A, chromosome 13 at 94,224,915 bp
  • C to T, chromosome 13 at 112,601,488 bp
  • T to G, chromosome 14 at 23,494,643 bp
  • T to C, chromosome 14 at 26,735,680 bp
  • T to C, chromosome 14 at 41,383,653 bp
  • T to A, chromosome 14 at 55,704,941 bp
  • A to T, chromosome 15 at 76,173,541 bp
  • T to C, chromosome 15 at 80,380,470 bp
  • A to T, chromosome 15 at 82,760,033 bp
  • A to G, chromosome 16 at 17,209,746 bp
  • T to C, chromosome 16 at 22,572,713 bp
  • C to T, chromosome 16 at 30,272,962 bp
  • T to C, chromosome 16 at 36,970,370 bp
  • C to T, chromosome 17 at 17,877,392 bp
  • T to C, chromosome 17 at 22,559,051 bp
  • A to G, chromosome 17 at 36,978,034 bp
  • A to G, chromosome 17 at 42,502,735 bp
  • T to C, chromosome 17 at 46,550,904 bp
  • A to G, chromosome 18 at 46,850,678 bp
  • C to T, chromosome 18 at 61,081,004 bp
  • C to T, chromosome 19 at 4,460,867 bp
  • T to A, chromosome 19 at 53,233,853 bp
  • G to T, chromosome 19 at 59,345,352 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7017 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045118-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.