Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6878Btlr/Mmmh
Stock Number:
044974-MU
Citation ID:
RRID:MMRRC_044974-MU
Other Names:
R6878 (G1)
Major Collection:

Strain Information

Hps5
Name: HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonyms: ru-2, ruby eye 2, ru2, Hermansky-Pudlak syndrome 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246694
Homologene: 35333
Ntrk3
Name: neurotrophic tyrosine kinase, receptor, type 3
Synonyms: TrkC
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18213
HGNC: HGNC:8033
Homologene: 49183
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Rpap1
Name: RNA polymerase II associated protein 1
Synonyms: 1190005L06Rik, A730023M06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68925
Homologene: 32269
Arhgap35
Name: Rho GTPase activating protein 35
Synonyms: P190 RhoGAP, 6430596G11Rik, p190RhoGAP, p190A, Grlf1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232906
HGNC: HGNC:4591
Homologene: 35136
Snx6
Name: sorting nexin 6
Synonyms: 2610032J07Rik, 2010006G21Rik, 2810425K19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72183
VEGA: 12
Homologene: 12304
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Hif1a
Name: hypoxia inducible factor 1, alpha subunit
Synonyms: MOP1, HIF-1alpha, HIF1alpha, bHLHe78
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15251
HGNC: HGNC:4910
Homologene: 1171
Tbl1xr1
Name: transducin (beta)-like 1X-linked receptor 1
Synonyms: Ira1, TBLR1, DC42, C21, C230089I12Rik, A630076E03Rik, 8030499H02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81004
Homologene: 69382
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Yy1
Name: YY1 transcription factor
Synonyms: UCRBP transcription factor, delta transcription factor, NF-E1, Yin Yang 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22632
Homologene: 2556
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104806
VEGA: 12
Homologene: 35378
Cilp
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214425
HGNC: HGNC:1980
Homologene: 2679
Ccl1
Name: C-C motif chemokine ligand 1
Synonyms: I-309, CCR8 ligand, Tca-3, Scya1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20290
Homologene: 55541
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Mfsd6
Name: major facilitator superfamily domain containing 6
Synonyms: 9630025I22Rik, MMR2, 2210010L05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98682
Homologene: 9784
Bpifb2
Name: BPI fold containing family B, member 2
Synonyms: 2310034L21Rik, 2310069A01Rik, Bpil1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66557
Homologene: 11884
Sema3a
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: SemD, semaphorin III, sema III, collapsin-1, Semad
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20346
Homologene: 31358
Rp1l1
Name: retinitis pigmentosa 1 homolog like 1
Synonyms: Dcdc4, Rp1hl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 271209
VEGA: 14
Homologene: 105870
Atg2a
Name: autophagy related 2A
Synonyms: 1810013C15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 329015
Homologene: 86985
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: B430315C20Rik, Hisppd2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Meikin
Name: meiotic kinetochore factor
Synonyms: 4930404A10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74847
Homologene: 54900
Lrrc49
Name: leucine rich repeat containing 49
Synonyms: D430025H09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102747
Homologene: 9782
Arhgap26
Name: Rho GTPase activating protein 26
Synonyms: 1810044B20Rik, 2610010G17Rik, 4933432P15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71302
Homologene: 36349
Myrf
Name: myelin regulatory factor
Synonyms: LOC225908, LOC386531, Gm98
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225908
HGNC: HGNC:1181
Homologene: 32167
Parva
Name: parvin, alpha
Synonyms: CH-ILKBP, 5430400F08Rik, 2010012A22Rik, actopaxin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57342
Homologene: 10077
Mis18a
Name: MIS18 kinetochore protein A
Synonyms: 2810018N07Rik, 2610039C10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66578
HGNC: HGNC:1286
Homologene: 41294
Prl7c1
Name: prolactin family 7, subfamily c, member 1
Synonyms: PLP-O, 1600017N11Rik, Prlpo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67505
Homologene: 137377
Upk3b
Name: uroplakin 3B
Synonyms: PMS2L14, UpIIIb, P35
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100647
Homologene: 18435
Cd47
Name: CD47 antigen (Rh-related antigen, integrin-associated signal transducer)
Synonyms: Itgp, 9130415E20Rik, B430305P08Rik, integrin-associated protein, IAP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16423
HGNC: HGNC:1682
Homologene: 1346
Speer4f2
Name: spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms: Gm3535, Gm3495
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100041749
Obox2
Name: oocyte specific homeobox 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246792
Homologene: 44937
Or8k32
Name: olfactory receptor family 8 subfamily K member 32
Synonyms: GA_x6K02T2Q125-48024195-48023254, MOR189-1, Olfr1079
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258402
Homologene: 74090
Tmed7
Name: transmembrane p24 trafficking protein 7
Synonyms: 5830493P14Rik, 3930401E15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66676
Homologene: 45644
Vmn2r29
Name: vomeronasal 2, receptor 29
Synonyms: 6430701C03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76229
Homologene: 113703
Myl2
Name: myosin, light polypeptide 2, regulatory, cardiac, slow
Synonyms: MLC-2v, MLC-2, Mlc2v, Mylpc, Gm32672
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17906
HGNC: HGNC:7583
Homologene: 55462
Asl
Name: argininosuccinate lyase
Synonyms: 2510006M18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109900
HGNC: HGNC:746
Homologene: 32
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Rab15
Name: RAB15, member RAS oncogene family
Synonyms: 2310012G06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104886
Homologene: 64471
Alyreffm5
Name: Aly/REF export factor family member 5
Synonyms: Gm4302
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100043227
VEGA: 10
Homologene: 130068
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 52,708,753 bp
  • A to G, chromosome 2 at 86,538,765 bp
  • T to A, chromosome 2 at 91,169,857 bp
  • A to T, chromosome 2 at 119,778,176 bp
  • A to G, chromosome 2 at 121,311,936 bp
  • C to T, chromosome 2 at 150,266,486 bp
  • A to G, chromosome 2 at 153,875,912 bp
  • T to G, chromosome 3 at 22,203,204 bp
  • T to C, chromosome 4 at 40,809,694 bp
  • A to T, chromosome 5 at 13,455,544 bp
  • T to G, chromosome 5 at 17,375,767 bp
  • T to C, chromosome 5 at 122,105,077 bp
  • A to G, chromosome 5 at 130,024,292 bp
  • T to C, chromosome 5 at 136,039,147 bp
  • A to G, chromosome 7 at 7,241,864 bp
  • G to T, chromosome 7 at 15,397,320 bp
  • A to G, chromosome 7 at 16,565,113 bp
  • T to C, chromosome 7 at 19,200,612 bp
  • C to G, chromosome 7 at 46,783,634 bp
  • T to A, chromosome 7 at 78,304,372 bp
  • T to A, chromosome 7 at 112,576,449 bp
  • A to G, chromosome 9 at 53,556,599 bp
  • A to G, chromosome 9 at 60,680,148 bp
  • G to A, chromosome 9 at 65,279,847 bp
  • T to C, chromosome 10 at 5,420,388 bp
  • T to C, chromosome 10 at 82,060,695 bp
  • TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA to TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA, chromosome 10 at 100,341,499 bp
  • CAG to CAGAAG, chromosome 10 at 100,341,507 bp
  • GCA to GCACCA, chromosome 10 at 100,341,515 bp
  • T to C, chromosome 11 at 54,411,886 bp
  • T to C, chromosome 11 at 79,434,882 bp
  • T to C, chromosome 11 at 82,179,693 bp
  • T to C, chromosome 12 at 54,763,601 bp
  • A to T, chromosome 12 at 65,116,423 bp
  • T to C, chromosome 12 at 73,928,281 bp
  • T to C, chromosome 12 at 76,804,483 bp
  • C to G, chromosome 12 at 108,814,756 bp
  • T to C, chromosome 13 at 27,778,844 bp
  • A to T, chromosome 13 at 81,433,494 bp
  • A to G, chromosome 14 at 64,031,852 bp
  • T to C, chromosome 16 at 15,777,072 bp
  • A to G, chromosome 16 at 49,910,869 bp
  • A to T, chromosome 16 at 90,721,756 bp
  • T to A, chromosome 18 at 36,947,363 bp
  • A to T, chromosome 18 at 39,227,412 bp
  • A to T, chromosome 18 at 46,593,465 bp
  • T to A, chromosome 19 at 6,250,178 bp
  • T to C, chromosome 19 at 10,216,478 bp
  • G to C, chromosome 19 at 40,376,800 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6878 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044974-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.