Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6869Btlr/Mmmh
Stock Number:
044966-MU
Citation ID:
RRID:MMRRC_044966-MU
Other Names:
R6869 (G1)
Major Collection:

Strain Information

Cpe
Name: carboxypeptidase E
Synonyms: carboxypeptidase H, CPH, Cph1, Cph-1, NF-alpha1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12876
HGNC: HGNC:2303
Homologene: 48052
Pik3cb
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit beta
Synonyms: 1110001J02Rik, p110beta
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74769
HGNC: HGNC:8976
Homologene: 21250
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Ranbp17
Name: RAN binding protein 17
Synonyms: 4932704E15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66011
Homologene: 36409
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Hells
Name: helicase, lymphoid specific
Synonyms: Lysh, proliferation-associated SNF2-like, PASG, LSH, YFK8, E130115I21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15201
HGNC: HGNC:4861
Homologene: 50037
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Fam91a1
Name: family with sequence similarity 91, member A1
Synonyms: D15Ertd621e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 210998
VEGA: 15
Homologene: 13388
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Chchd6
Name: coiled-coil-helix-coiled-coil-helix domain containing 6
Synonyms: 1700021B03Rik, 0710001P09Rik, Micos25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66098
Homologene: 11920
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Rcbtb1
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms: 5430409I18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71330
Homologene: 10061
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Nckap5l
Name: NCK-associated protein 5-like
Synonyms: C230021P08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380969
Homologene: 18924
Pdcd6ip
Name: programmed cell death 6 interacting protein
Synonyms: Alix, AIP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18571
HGNC: HGNC:8766
Homologene: 22614
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Nectin3
Name: nectin cell adhesion molecule 3
Synonyms: nectin-3, 4921513D19Rik, 2610301B19Rik, 3000002N23Rik, Pvrl3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 58998
Homologene: 9162
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Cyp1a1
Name: cytochrome P450, family 1, subfamily a, polypeptide 1
Synonyms: cytochrome P450 subfamily I, polypeptide 1, P450-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13076
VEGA: 9
HGNC: HGNC:2595
Homologene: 68062
Nrros
Name: negative regulator of reactive oxygen species
Synonyms: E430025L02Rik, Lrrc33
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224109
Homologene: 17134
Itgb1
Name: integrin beta 1 (fibronectin receptor beta)
Synonyms: CD29, beta1 integrin, 4633401G24Rik, Fnrb, Gm9863
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16412
HGNC: HGNC:6153
Homologene: 22999
Retreg3
Name: reticulophagy regulator family member 3
Synonyms: 4933404C01Rik, 1300010M03Rik, Fam134c
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67998
Homologene: 23585
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Itga2
Name: integrin alpha 2
Synonyms: VLA-2 receptor, alpha 2 subunit, CD49B, DX5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16398
VEGA: 13
HGNC: HGNC:6137
Homologene: 1662
Arhgap30
Name: Rho GTPase activating protein 30
Synonyms: 6030405P05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226652
Homologene: 18766
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Lmod2
Name: leiomodin 2 (cardiac)
Synonyms: C-Lmod
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 93677
HGNC: HGNC:6648
Homologene: 28302
Ppp1r3a
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140491
HGNC: HGNC:9291
Homologene: 48124
Gen1
Name: GEN1, Holliday junction 5' flap endonuclease
Synonyms: 5830483C08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209334
VEGA: 12
Homologene: 35313
Vmn1r78
Name: vomeronasal 1 receptor 78
Synonyms: V1rg7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171242
Homologene: 74316
Lrrc43
Name: leucine rich repeat containing 43
Synonyms: LOC381741
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381741
Homologene: 17662
Bpifb5
Name: BPI fold containing family B, member 5
Synonyms: BC018465
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228802
Homologene: 64814
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Unc79
Name: unc-79 homolog
Synonyms: 9030205A07Rik, Mlca3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
F830045P16Rik
Name: RIKEN cDNA F830045P16 gene
Synonyms: Sirpb3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228592
Homologene: 136180
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Gm4922
Name: predicted gene 4922
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237300
VEGA: 10
Homologene: 50497
Msh5
Name: mutS homolog 5
Synonyms: G7, Mut5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17687
HGNC: HGNC:7328
Homologene: 8415
Oxa1l
Name: oxidase assembly 1-like
Synonyms: 1810020M02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69089
HGNC: HGNC:8526
Homologene: 31281
Strip1
Name: striatin interacting protein 1
Synonyms: 6530401O14Rik, 6330569M22Rik, Fam40a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229707
Homologene: 35064
Sh3bgr
Name: SH3-binding domain glutamic acid-rich protein
Synonyms: 5430437A18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50795
Homologene: 56376
Ncan
Name: neurocan
Synonyms: Tgfbit, Cspg3, Cspg3-rs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13004
HGNC: HGNC:2465
Homologene: 3229
Wfdc8
Name: WAP four-disulfide core domain 8
Synonyms: LOC277343
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277343
Homologene: 33799
Zbtb49
Name: zinc finger and BTB domain containing 49
Synonyms: 4930518A03Rik, Zfp509
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75079
Homologene: 34825
H2-Ab1
Name: histocompatibility 2, class II antigen A, beta 1
Synonyms: A beta, Abeta, H-2Ab, Ia-2, Ia2, H2-Ab, IAb, I-Ab, I-Abeta, Rmcs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14961
Homologene: 1603
Or52r1c
Name: olfactory receptor family 52 subfamily R member 1C
Synonyms: GA_x6K02T2PBJ9-5796876-5797820, MOR30-2, Olfr584
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259056
Fastkd1
Name: FAST kinase domains 1
Synonyms: 5330408N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320720
Homologene: 36420
Aadacl4fm5
Name: AADACL4 family member 5
Synonyms: LOC329993, Gm438
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329993
Homologene: 135765
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Tas2r138
Name: taste receptor, type 2, member 138
Synonyms: mt2r31, Tas2r38, T2R138
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387513
HGNC: HGNC:9584
Homologene: 47976
Tymp
Name: thymidine phosphorylase
Synonyms: PDECGF, PD-ECGF, gliostatin, Pdgfec, 2900072D10Rik, Ecgf1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72962
VEGA: 15
HGNC: HGNC:3148
Homologene: 1474
Or5aq1b
Name: olfactory receptor family 5 subfamily AQ member 1B
Synonyms: GA_x6K02T2Q125-48565383-48564445, MOR172-2, Olfr1107
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258841
Homologene: 131138
Dcstamp
Name: dendrocyte expressed seven transmembrane protein
Synonyms: 4833414I07Rik, DC-STAMP, Tm7sf4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75766
VEGA: 15
Homologene: 12769
Ankdd1b
Name: ankyrin repeat and death domain containing 1B
Synonyms: 9330128J19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 271144
Homologene: 19566
Rhobtb1
Name: Rho-related BTB domain containing 1
Synonyms: 1700008H16Rik, 3110048G13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69288
Homologene: 8892
Lbx1
Name: ladybird homeobox 1
Synonyms: Lbx1h
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16814
Homologene: 4784
Zfp579
Name: zinc finger protein 579
Synonyms: 1110003A17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68490
Homologene: 17629
Fgf20
Name: fibroblast growth factor 20
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80857
HGNC: HGNC:3677
Homologene: 10527
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • G to T, chromosome 1 at 171,409,055 bp
  • G to A, chromosome 2 at 69,702,760 bp
  • T to A, chromosome 2 at 87,071,673 bp
  • T to C, chromosome 2 at 129,474,561 bp
  • T to C, chromosome 2 at 154,233,223 bp
  • T to C, chromosome 2 at 160,965,730 bp
  • C to T, chromosome 2 at 164,599,092 bp
  • G to A, chromosome 2 at 180,191,662 bp
  • T to C, chromosome 3 at 107,613,445 bp
  • A to C, chromosome 4 at 40,261,201 bp
  • T to A, chromosome 4 at 84,293,496 bp
  • A to G, chromosome 4 at 139,467,227 bp
  • A to T, chromosome 4 at 144,780,472 bp
  • G to T, chromosome 5 at 38,214,350 bp
  • G to A, chromosome 5 at 123,504,276 bp
  • A to C, chromosome 6 at 14,754,826 bp
  • T to C, chromosome 6 at 24,604,127 bp
  • A to G, chromosome 6 at 40,612,421 bp
  • T to C, chromosome 6 at 89,595,496 bp
  • T to C, chromosome 6 at 131,486,438 bp
  • G to T, chromosome 7 at 4,994,461 bp
  • A to G, chromosome 7 at 12,152,749 bp
  • T to A, chromosome 7 at 55,907,365 bp
  • C to T, chromosome 7 at 80,362,945 bp
  • GGCG to GGCGACGGCTGCG, chromosome 7 at 97,579,906 bp
  • G to A, chromosome 7 at 103,085,868 bp
  • T to C, chromosome 8 at 40,281,148 bp
  • T to C, chromosome 8 at 41,082,654 bp
  • A to G, chromosome 8 at 64,619,427 bp
  • A to T, chromosome 8 at 70,107,907 bp
  • A to G, chromosome 8 at 94,521,955 bp
  • A to G, chromosome 8 at 128,720,035 bp
  • A to T, chromosome 9 at 57,702,784 bp
  • A to T, chromosome 9 at 99,060,259 bp
  • A to G, chromosome 9 at 113,655,106 bp
  • A to T, chromosome 10 at 18,784,515 bp
  • T to C, chromosome 10 at 28,473,059 bp
  • T to C, chromosome 10 at 69,270,226 bp
  • T to G, chromosome 10 at 79,542,669 bp
  • T to C, chromosome 11 at 33,513,074 bp
  • T to A, chromosome 11 at 69,429,471 bp
  • G to A, chromosome 11 at 101,119,818 bp
  • A to T, chromosome 12 at 11,241,441 bp
  • T to C, chromosome 12 at 101,480,737 bp
  • A to T, chromosome 12 at 103,113,072 bp
  • A to T, chromosome 13 at 96,444,291 bp
  • G to A, chromosome 13 at 114,875,537 bp
  • C to T, chromosome 14 at 54,366,738 bp
  • T to C, chromosome 14 at 59,217,602 bp
  • T to C, chromosome 15 at 39,754,458 bp
  • T to A, chromosome 15 at 58,431,268 bp
  • T to C, chromosome 15 at 89,376,691 bp
  • C to A, chromosome 15 at 97,796,176 bp
  • A to G, chromosome 15 at 99,426,453 bp
  • A to G, chromosome 16 at 32,144,431 bp
  • A to T, chromosome 16 at 37,204,448 bp
  • G to A, chromosome 16 at 46,395,143 bp
  • A to G, chromosome 16 at 96,206,660 bp
  • T to C, chromosome 17 at 34,267,563 bp
  • A to T, chromosome 17 at 35,041,834 bp
  • A to G, chromosome 19 at 38,940,635 bp
  • T to A, chromosome 19 at 40,809,454 bp
  • T to A, chromosome 19 at 45,234,951 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6869 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.