Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6684Btlr/Mmmh
Stock Number:
044803-MU
Citation ID:
RRID:MMRRC_044803-MU
Other Names:
R6684 (G1)
Major Collection:

Strain Information

Zfp42
Name: zinc finger protein 42
Synonyms: Rex-1, Zfp-42, Rex1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22702
Homologene: 7601
Lims1
Name: LIM and senescent cell antigen-like domains 1
Synonyms: 2310016J22Rik, 4921524A02Rik, Lims1l, PINCH1, C430041B13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110829
HGNC: HGNC:6616
Homologene: 68428
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: Pp4r1, 3110001J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Plcg2
Name: phospholipase C, gamma 2
Synonyms: Plcg-2, PLCgamma2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234779
HGNC: HGNC:9066
Homologene: 55671
Ehd4
Name: EH-domain containing 4
Synonyms: 2210022F10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98878
HGNC: HGNC:3245
Homologene: 26430
Capns1
Name: calpain, small subunit 1
Synonyms: Capa-4, Capa4, Capn4, D7Ertd146e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12336
HGNC: HGNC:1481
Homologene: 1327
Abcf2
Name: ATP-binding cassette, sub-family F member 2
Synonyms: 0710005O05Rik, Drr3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27407
Homologene: 21408
Polr3g
Name: polymerase (RNA) III (DNA directed) polypeptide G
Synonyms: RPC32, 2310047G20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67486
Homologene: 38184
Dapk1
Name: death associated protein kinase 1
Synonyms: 2310039H24Rik, 2810425C21Rik, D13Ucla1, DAP-Kinase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Ythdc2
Name: YTH domain containing 2
Synonyms: 3010002F02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240255
Homologene: 11265
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623474
Homologene: 8240
Trim58
Name: tripartite motif-containing 58
Synonyms: LOC216781, LOC386443
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216781
Homologene: 9135
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Pmfbp1
Name: polyamine modulated factor 1 binding protein 1
Synonyms: F77, 1700016D22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56523
Homologene: 23182
Gm10801
Name: predicted gene 10801
Type: Gene
Species: Mouse
Chromosome: 2
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Or5p79
Name: olfactory receptor family 5 subfamily P member 79
Synonyms: GA_x6K02T2PBJ9-10951546-10952496, MOR204-7, Olfr507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258738
Homologene: 27249
Cr2
Name: complement receptor 2
Synonyms: CD21, CD35, Cr-1, Cr-2, Cr1, C3DR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Galnt7
Name: polypeptide N-acetylgalactosaminyltransferase 7
Synonyms: ppGaNTase-T7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108150
HGNC: HGNC:4129
Homologene: 9685
Lcn3
Name: lipocalin 3
Synonyms: Vnsp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16820
Homologene: 74958
Phtf2
Name: putative homeodomain transcription factor 2
Synonyms: 9530062N20Rik, 1110054G21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68770
Homologene: 10713
Tmem71
Name: transmembrane protein 71
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213068
VEGA: 15
Homologene: 51638
Orai3
Name: ORAI calcium release-activated calcium modulator 3
Synonyms: Tmem142c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269999
Homologene: 72082
Rasl10a
Name: RAS-like, family 10, member A
Synonyms: 2210403B10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75668
Homologene: 4732
Vash1
Name: vasohibin 1
Synonyms: G630009D10Rik, D930046M13Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238328
Homologene: 8941
Lkaaear1
Name: LKAAEAR motif containing 1 (IKAAEAR murine motif)
Synonyms: LOC277496, 4930526D03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277496
Homologene: 52380
Fam221a
Name: family with sequence similarity 221, member A
Synonyms: D330028D13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231946
Homologene: 18214
Pcdhga7
Name: protocadherin gamma subfamily A, 7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93715
HGNC: HGNC:8705
Homologene: 36377
Fam81b
Name: family with sequence similarity 81, member B
Synonyms: LOC238726
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238726
Homologene: 17616
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 195,171,021 bp
  • A to T, chromosome 2 at 25,766,158 bp
  • T to C, chromosome 2 at 87,509,404 bp
  • C to CGTA, chromosome 2 at 98,663,807 bp
  • T to C, chromosome 2 at 112,753,088 bp
  • A to G, chromosome 2 at 120,154,334 bp
  • TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG to TCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAG, chromosome 2 at 181,697,561 bp
  • T to C, chromosome 4 at 11,583,689 bp
  • A to G, chromosome 5 at 20,812,939 bp
  • G to A, chromosome 5 at 24,569,139 bp
  • G to T, chromosome 6 at 49,372,608 bp
  • C to A, chromosome 7 at 30,193,899 bp
  • A to G, chromosome 7 at 45,336,532 bp
  • A to G, chromosome 7 at 108,621,934 bp
  • A to G, chromosome 7 at 127,773,720 bp
  • G to A, chromosome 8 at 43,296,056 bp
  • C to T, chromosome 8 at 57,538,109 bp
  • T to C, chromosome 8 at 109,535,830 bp
  • T to C, chromosome 8 at 117,596,332 bp
  • T to A, chromosome 10 at 58,399,013 bp
  • G to A, chromosome 11 at 5,058,396 bp
  • A to G, chromosome 11 at 58,651,620 bp
  • A to G, chromosome 12 at 86,688,909 bp
  • G to A, chromosome 13 at 24,022,542 bp
  • T to A, chromosome 13 at 60,760,894 bp
  • T to C, chromosome 13 at 67,320,277 bp
  • G to A, chromosome 13 at 76,202,038 bp
  • A to T, chromosome 13 at 81,699,531 bp
  • A to G, chromosome 15 at 66,541,690 bp
  • T to G, chromosome 16 at 56,259,929 bp
  • G to A, chromosome 17 at 65,824,342 bp
  • T to C, chromosome 18 at 37,716,050 bp
  • T to C, chromosome 18 at 44,873,069 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6684 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
044803-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.