Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5783Btlr/Mmmh
Stock Number:
043380-MU
Citation ID:
RRID:MMRRC_043380-MU
Other Names:
R5783 (G1)
Major Collection:

Strain Information

St8sia1
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 1
Synonyms: alpha-2,8-sialyltransferase, ST8Sia I, GD3S, GD3 synthase, Siat8, Siat8a, 9330109E03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20449
Homologene: 2282
Mtss1
Name: MTSS I-BAR domain containing 1
Synonyms: MIM, D130001D01Rik, 2310003N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 211401
VEGA: 15
Homologene: 8841
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Rapgef2
Name: Rap guanine nucleotide exchange factor (GEF) 2
Synonyms: 5830453M24Rik, Pdzgef1, RA-GEF-1, CNRasGEF, nRapGEP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76089
Homologene: 35477
Kcnc4
Name: potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms: Kv3.4, Kcr2-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99738
HGNC: HGNC:6236
Homologene: 68427
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Chka
Name: choline kinase alpha
Synonyms: choline/ethanolamine kinase alpha, CK/EK-alpha, ChoK, EtnK-alpha, Chk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12660
HGNC: HGNC:1937
Homologene: 88575
Zc3h14
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75553
VEGA: 12
Homologene: 32605
Osbpl8
Name: oxysterol binding protein-like 8
Synonyms: ORP-8, D330025H14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237542
VEGA: 10
Homologene: 68813
Cep78
Name: centrosomal protein 78
Synonyms: 5730599I05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 208518
VEGA: 19
Homologene: 11030
Lars2
Name: leucyl-tRNA synthetase, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102436
VEGA: 9
Homologene: 6526
Cald1
Name: caldesmon 1
Synonyms: 4833423D12Rik, C920027I18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109624
HGNC: HGNC:1441
Homologene: 137254
Zfp617
Name: zinc finger protein 617
Synonyms: Zfps11-6, Zinc finger protein s11-6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170938
Homologene: 135689
Zfp318
Name: zinc finger protein 318
Synonyms: TZF, 2610034E08Rik, D530032D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57908
Homologene: 22808
Slc41a3
Name: solute carrier family 41, member 3
Synonyms: SLC41A1-L2, 1010001P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71699
Homologene: 23052
Ppp2r5a
Name: protein phosphatase 2, regulatory subunit B', alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226849
HGNC: HGNC:9309
Homologene: 55961
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Cenpe
Name: centromere protein E
Synonyms: N-7 kinesin, CENP-E, 312kDa, Kif10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Uqcrfs1
Name: ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Synonyms: 4430402G14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66694
Homologene: 4378
Scamp5
Name: secretory carrier membrane protein 5
Synonyms: Sc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56807
VEGA: 9
Homologene: 56880
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Pgap3
Name: post-GPI attachment to proteins 3
Synonyms: CAB2, D430035D22Rik, Perld1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320655
Homologene: 5484
Zmiz2
Name: zinc finger, MIZ-type containing 2
Synonyms: 2410117E06Rik, D11Bwg0280e, Zimp7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52915
Homologene: 18000
Kctd19
Name: potassium channel tetramerisation domain containing 19
Synonyms: 4922504H04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 279499
Homologene: 18630
Sybu
Name: syntabulin (syntaxin-interacting)
Synonyms: A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Dnaaf9
Name: dynein axonemal assembly factor 9
Synonyms: 4930402H24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228602
Homologene: 12623
Or51m1
Name: olfactory receptor family 51 subfamily M member 1
Synonyms: GA_x6K02T2PBJ9-6662699-6663658, MOR3-1, Olfr631
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258961
Homologene: 64935
Vrtn
Name: vertebrae development associated
Synonyms: 7420416P09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432677
VEGA: 12
Homologene: 41236
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Dennd5a
Name: DENN domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19347
Homologene: 14584
Dnm3
Name: dynamin 3
Synonyms: B230343F03Rik, 9630020E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 103967
Homologene: 22906
Shoc1
Name: shortage in chiasmata 1
Synonyms: LOC242489, Gm426, AI481877, Mzip2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100155
Homologene: 79783
Tmem266
Name: transmembrane protein 266
Synonyms: AI118078
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244886
Homologene: 17551
Impdh1
Name: inosine monophosphate dehydrogenase 1
Synonyms: B930086D20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23917
HGNC: HGNC:6052
Homologene: 68096
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4930432K16Rik, 4921529O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
Or8k30
Name: olfactory receptor family 8 subfamily K member 30
Synonyms: GA_x6K02T2Q125-47993761-47994702, MOR189-2, Olfr1076
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258401
Homologene: 17233
Mrgprh
Name: MAS-related GPR, member H
Synonyms: MrgH, Gpr90
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 80978
VEGA: 17
Homologene: 12758
Krt80
Name: keratin 80
Synonyms: 2310041I20Rik, 1200016G03Rik, Kb20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74127
VEGA: 15
Homologene: 66610
Rusc1
Name: RUN and SH3 domain containing 1
Synonyms: 2210403N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72296
Homologene: 75028
Or2ag13
Name: olfactory receptor family 2 subfamily AG member 13
Synonyms: GA_x6K02T2PBJ9-9092181-9091234, MOR283-6, Olfr695
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258591
Homologene: 133597
H2bc21
Name: H2B clustered histone 21
Synonyms: Hist2h2be
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319190
HGNC: HGNC:4761
Homologene: 128594
1700093K21Rik
Name: RIKEN cDNA 1700093K21 gene
Synonyms: b2b3025Clo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67358
Homologene: 49849
Mogs
Name: mannosyl-oligosaccharide glucosidase
Synonyms: 1810017N02Rik, Gcs1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57377
Homologene: 4593
Smad9
Name: SMAD family member 9
Synonyms: Madh9, SMAD8B, SMAD8A, MADH6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55994
HGNC: HGNC:6774
Homologene: 21198
Smim8
Name: small integral membrane protein 8
Synonyms: 2810406B13Rik, 1810030N24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66291
Homologene: 10708
Fen1
Name: flap structure specific endonuclease 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14156
HGNC: HGNC:3650
Homologene: 3034
Pcdha5
Name: protocadherin alpha 5
Synonyms: Cnr6, Crnr6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12941
HGNC: HGNC:8671
Homologene: 49565
Mesdc2
Name:
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 7
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 162,355,471 bp
  • A to T, chromosome 1 at 191,354,640 bp
  • T to C, chromosome 2 at 86,508,638 bp
  • C to T, chromosome 2 at 112,652,998 bp
  • A to C, chromosome 2 at 130,739,083 bp
  • T to C, chromosome 3 at 54,794,442 bp
  • T to G, chromosome 3 at 79,087,993 bp
  • T to C, chromosome 3 at 89,088,145 bp
  • T to C, chromosome 3 at 96,221,299 bp
  • T to C, chromosome 3 at 107,447,872 bp
  • A to G, chromosome 3 at 135,261,580 bp
  • TTTAATGAAGAGCT to TT, chromosome 4 at 34,771,261 bp
  • A to T, chromosome 4 at 59,076,239 bp
  • T to G, chromosome 5 at 114,064,935 bp
  • A to T, chromosome 6 at 29,206,343 bp
  • G to A, chromosome 6 at 34,753,533 bp
  • C to T, chromosome 6 at 83,118,671 bp
  • G to A, chromosome 6 at 83,944,847 bp
  • T to C, chromosome 6 at 90,619,542 bp
  • T to C, chromosome 6 at 142,963,614 bp
  • G to T, chromosome 7 at 45,310,389 bp
  • T to A, chromosome 7 at 83,895,675 bp
  • A to T, chromosome 7 at 103,928,942 bp
  • C to A, chromosome 7 at 106,873,334 bp
  • A to C, chromosome 7 at 109,894,636 bp
  • G to T, chromosome 7 at 141,858,428 bp
  • C to A, chromosome 8 at 71,932,464 bp
  • A to G, chromosome 8 at 105,386,980 bp
  • A to G, chromosome 9 at 26,882,336 bp
  • G to T, chromosome 9 at 55,397,803 bp
  • A to G, chromosome 9 at 57,446,070 bp
  • T to G, chromosome 9 at 123,461,596 bp
  • T to A, chromosome 10 at 111,267,783 bp
  • T to C, chromosome 11 at 6,405,081 bp
  • T to A, chromosome 11 at 23,518,787 bp
  • A to C, chromosome 11 at 98,390,464 bp
  • A to G, chromosome 12 at 8,001,022 bp
  • A to G, chromosome 12 at 72,456,053 bp
  • T to A, chromosome 12 at 84,650,477 bp
  • T to A, chromosome 12 at 98,757,175 bp
  • A to G, chromosome 13 at 30,545,204 bp
  • T to C, chromosome 15 at 44,746,414 bp
  • C to T, chromosome 15 at 58,943,524 bp
  • C to T, chromosome 15 at 101,359,479 bp
  • T to C, chromosome 16 at 15,717,801 bp
  • C to A, chromosome 17 at 12,877,446 bp
  • TGAAGAAGAAGAAGAAGAAGAAGAAGAAG to TGAAGAAGAAGAAGAAGAAGAAG, chromosome 17 at 46,412,514 bp
  • T to C, chromosome 17 at 56,211,655 bp
  • T to C, chromosome 18 at 36,962,481 bp
  • A to G, chromosome 19 at 3,864,661 bp
  • A to C, chromosome 19 at 6,853,916 bp
  • G to T, chromosome 19 at 10,200,830 bp
  • G to T, chromosome 19 at 15,956,359 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5783 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043380-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.