Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR6011Btlr/Mmmh
Stock Number:
043253-MU
Citation ID:
RRID:MMRRC_043253-MU
Other Names:
R6011 (G1), C57BL/6J-MtgxR6011Btlr
Major Collection:

Strain Information

Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Clasp2
Name: CLIP associating protein 2
Synonyms: 1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76499
VEGA: 9
Homologene: 24944
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Niban2
Name: niban apoptosis regulator 2
Synonyms: 9130404D14Rik, Fam129b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227737
Homologene: 11269
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Ccser2
Name: coiled-coil serine rich 2
Synonyms: 1700012P13Rik, 2900054P12Rik, Gcap14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72972
Homologene: 10367
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
Lman1l
Name: lectin, mannose-binding 1 like
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235416
HGNC: HGNC:6632
Homologene: 11047
Cyp2c66
Name: cytochrome P450, family 2, subfamily c, polypeptide 66
Synonyms: 2010301M18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69888
Homologene: 133566
Slc4a1
Name: solute carrier family 4 (anion exchanger), member 1
Synonyms: erythrocyte membrane protein band 3, band 3, Empb3, Ae1, CD233, l11Jus51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20533
Homologene: 133556
Add2
Name: adducin 2
Synonyms: 2900072M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11519
HGNC: HGNC:244
Homologene: 1221
Lgsn
Name: lengsin, lens protein with glutamine synthetase domain
Synonyms: Lgs, lengsin, Gluld1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 266744
Homologene: 9569
Tmx4
Name: thioredoxin-related transmembrane protein 4
Synonyms: 4930500L08Rik, 2810417D04Rik, D2Bwg1356e, Txndc13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 52837
Homologene: 10901
Serpina12
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
Synonyms: vaspin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68054
Homologene: 23588
Bpifb2
Name: BPI fold containing family B, member 2
Synonyms: 2310034L21Rik, 2310069A01Rik, Bpil1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66557
Homologene: 11884
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Eml3
Name: echinoderm microtubule associated protein like 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225898
VEGA: 19
Homologene: 27044
Serpina1a
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1A
Synonyms: PI1, Aat-2, Spi1-1, Aat2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20700
HGNC: HGNC:8941
Homologene: 20103
Disp2
Name: dispatched RND transporter family member 2
Synonyms: DispB, B230210L08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214240
Homologene: 24916
Asic1
Name: acid-sensing ion channel 1
Synonyms: BNaC2, ASIC, ASIC1a, ASICalpha, ASIC1 beta, B530003N02Rik, ASIC1b, Accn2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11419
VEGA: 15
HGNC: HGNC:100
Homologene: 121755
Adamts15
Name: ADAM metallopeptidase with thrombospondin type 1 motif 15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235130
VEGA: 9
Homologene: 8610
Rfc3
Name: replication factor C (activator 1) 3
Synonyms: 2810416I22Rik, 38kDa, 38kDa, Recc3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69263
HGNC: HGNC:9971
Homologene: 2188
Pelo
Name: pelota mRNA surveillance and ribosome rescue factor
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105083
VEGA: 13
HGNC: HGNC:8829
Homologene: 6835
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Or9i1b
Name: olfactory receptor family 9 subfamily I member 1B
Synonyms: GA_x6K02T2RE5P-4250267-4251217, MOR211-4P, MOR211-10_i, Olfr1505
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258151
Homologene: 17394
Catsper3
Name: cation channel, sperm associated 3
Synonyms: 4921522D01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76856
Homologene: 12658
Sectm1b
Name: secreted and transmembrane 1B
Synonyms: K12, 1810003C24Rik, Sectm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58210
Homologene: 86740
Fktn
Name: fukutin
Synonyms: Fukutin, Fcmd
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 246179
HGNC: HGNC:3622
Homologene: 31402
Hmgxb3
Name: HMG box domain containing 3
Synonyms: 2510002C16Rik, A630042L21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106894
VEGA: 18
Homologene: 44229
Or6c8b
Name: olfactory receptor family 6 subfamily C member 8B
Synonyms: GA_x6K02T2PULF-10732607-10731678, MOR115-4, Olfr765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544748
Homologene: 105186
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Gm16485
Name: predicted gene 16485
Type: Gene
Species: Mouse
Chromosome: 9
Or7g25
Name: olfactory receptor family 7 subfamily G member 25
Synonyms: GA_x6K02T2PVTD-12986331-12985390, MOR155-2, Olfr843
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258560
HGNC: HGNC:8466
Homologene: 74251
Cyp3a44
Name: cytochrome P450, family 3, subfamily a, polypeptide 44
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 337924
HGNC: HGNC:2638
Homologene: 133568
Fhit
Name: fragile histidine triad gene
Synonyms: Fra14A2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14198
HGNC: HGNC:3701
Homologene: 21661
Ankrd13d
Name: ankyrin repeat domain 13 family, member D
Synonyms: 0710001P18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68423
Homologene: 27612
Clstn2
Name: calsyntenin 2
Synonyms: CS2, 2900042C18Rik, Cst-2, CSTN2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64085
Homologene: 49698
Or4k42
Name: olfactory receptor family 4 subfamily K member 42
Synonyms: GA_x6K02T2Q125-72541649-72540711, MOR248-9, Olfr1290
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257662
Homologene: 74248
Bhmt1b
Name: betaine--homocysteine S-methyltransferase 1B
Synonyms: Gm5096
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329008
VEGA: 18
HGNC: HGNC:1047
Or12e13
Name: olfactory receptor family 12 subfamily E member 13
Synonyms: GA_x6K02T2Q125-49334566-49335510, MOR264-7, Olfr1148
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258220
Homologene: 79465
Fam187a
Name: family with sequence similarity 187, member A
Synonyms: 4933439F11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66784
Homologene: 128440
Rpl35
Name: ribosomal protein L35
Synonyms: 2410039E09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66489
Homologene: 31432
Foxl3
Name: forkhead box L3
Synonyms: Gm5294
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384244
Homologene: 79931
Traj50
Name: T cell receptor alpha joining 50
Synonyms: Gm17007
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124338
Amer1
Name: APC membrane recruitment 1
Synonyms: 2810002O09Rik, Wtx, Amer1, Fam123b
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 72345
Homologene: 51852
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 31,203,766 bp
  • T to C, chromosome 2 at 32,922,865 bp
  • A to T, chromosome 2 at 39,004,801 bp
  • A to G, chromosome 2 at 87,833,915 bp
  • C to A, chromosome 2 at 111,489,847 bp
  • G to A, chromosome 2 at 118,790,820 bp
  • A to T, chromosome 2 at 134,639,836 bp
  • A to G, chromosome 2 at 153,889,576 bp
  • G to A, chromosome 4 at 53,724,627 bp
  • C to T, chromosome 4 at 132,499,397 bp
  • G to A, chromosome 5 at 111,286,443 bp
  • A to G, chromosome 5 at 138,821,619 bp
  • A to G, chromosome 5 at 145,801,274 bp
  • T to A, chromosome 5 at 151,643,719 bp
  • T to C, chromosome 6 at 86,098,625 bp
  • A to T, chromosome 9 at 8,972,453 bp
  • T to A, chromosome 9 at 19,248,511 bp
  • G to T, chromosome 9 at 30,902,786 bp
  • A to T, chromosome 9 at 57,615,755 bp
  • C to T, chromosome 9 at 97,456,526 bp
  • C to T, chromosome 9 at 113,876,247 bp
  • A to T, chromosome 10 at 129,046,639 bp
  • T to A, chromosome 11 at 84,245,744 bp
  • T to C, chromosome 11 at 85,032,097 bp
  • A to C, chromosome 11 at 102,352,531 bp
  • A to G, chromosome 11 at 102,885,441 bp
  • C to T, chromosome 11 at 121,055,878 bp
  • T to C, chromosome 12 at 40,817,757 bp
  • T to A, chromosome 12 at 103,857,469 bp
  • A to G, chromosome 12 at 104,035,734 bp
  • A to G, chromosome 13 at 55,786,492 bp
  • A to G, chromosome 13 at 115,089,766 bp
  • T to C, chromosome 14 at 9,870,068 bp
  • T to C, chromosome 14 at 36,879,575 bp
  • C to T, chromosome 14 at 51,364,348 bp
  • T to C, chromosome 14 at 54,167,634 bp
  • T to G, chromosome 15 at 27,735,545 bp
  • G to T, chromosome 15 at 99,699,079 bp
  • T to C, chromosome 16 at 35,157,228 bp
  • T to A, chromosome 17 at 35,622,182 bp
  • G to A, chromosome 18 at 61,163,024 bp
  • A to G, chromosome 18 at 87,756,539 bp
  • A to G, chromosome 19 at 4,281,934 bp
  • T to C, chromosome 19 at 8,939,107 bp
  • G to A, chromosome 19 at 13,919,157 bp
  • A to G, chromosome 19 at 17,118,716 bp
  • A to G, chromosome 19 at 39,141,936 bp
  • ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC to ATTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC, chromosome X at 95,427,283 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R6011 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043253-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.