Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5701Btlr/Mmmh
Stock Number:
043181-MU
Citation ID:
RRID:MMRRC_043181-MU
Other Names:
R5701 (G1), C57BL/6J-MtgxR5701Btlr
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Rnf145
Name: ring finger protein 145
Synonyms: 3732413I11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74315
Homologene: 14427
Rbm25
Name: RNA binding motif protein 25
Synonyms: 2610015J01Rik, A130095G20Rik, 2600011C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67039
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Armc8
Name: armadillo repeat containing 8
Synonyms: HSPC056, 1200015K23Rik, Gid5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74125
Homologene: 9121
Asxl1
Name: ASXL transcriptional regulator 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228790
Homologene: 9098
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Ep300
Name: E1A binding protein p300
Synonyms: p300, KAT3B
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328572
HGNC: HGNC:3373
Homologene: 1094
Gps1
Name: G protein pathway suppressor 1
Synonyms: COPS1, Csn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 209318
HGNC: HGNC:4549
Homologene: 3046
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Mcm2
Name: minichromosome maintenance complex component 2
Synonyms: CDCL1, BM28, Mcmd2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17216
HGNC: HGNC:6944
Homologene: 3325
Cand2
Name: cullin associated and neddylation dissociated 2 (putative)
Synonyms: Tp120b, 2210404G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67088
Homologene: 41657
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Muc19
Name: mucin 19
Synonyms: apomucin, sld
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 15
NCBI: 239611
Myo6
Name: myosin VI
Synonyms: Tlc, Myo6rsv, rsv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17920
HGNC: HGNC:7605
Homologene: 56417
Cacna2d2
Name: calcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonyms: a2d2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56808
HGNC: HGNC:1400
Homologene: 4400
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Gabrb2
Name: gamma-aminobutyric acid type A receptor subunit beta 2
Synonyms: Gabrb-2, C030021G16Rik, C030002O17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14401
HGNC: HGNC:4082
Homologene: 7327
Chrnd
Name: cholinergic receptor, nicotinic, delta polypeptide
Synonyms: Achr-4, Acrd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11447
HGNC: HGNC:1965
Homologene: 37340
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Synpo2
Name: synaptopodin 2
Synonyms: myopodin, Myo, 1110069I04Rik, 9530006G20Rik, 2310068J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 118449
Homologene: 15400
Gbp4
Name: guanylate binding protein 4
Synonyms: Mag-2, Mpa-2, Mpa2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17472
Homologene: 128731
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Slc66a2
Name: solute carrier family 66 member 2
Synonyms: C78974, 5730564E11Rik, 4933425L21Rik, 2310009N05Rik, Pqlc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66943
Homologene: 32623
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231591
Homologene: 129606
Mex3d
Name: mex3 RNA binding family member D
Synonyms: Rkhd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237400
Homologene: 16890
Hoxc9
Name: homeobox C9
Synonyms: Hox-3.2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15427
HGNC: HGNC:5130
Homologene: 130558
Or5m11
Name: olfactory receptor family 5 subfamily M member 11
Synonyms: GA_x6K02T2Q125-47430129-47431103, MOR198-3P, MOR198-6_p, MOR198-3P, MOR198-4, Olfr1534-ps1, Olfr1028
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257936
Homologene: 73972
Zfp316
Name: zinc finger protein 316
Synonyms: Emzf1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54201
Homologene: 69231
Mptx2
Name: mucosal pentraxin 2
Synonyms: Gm11062
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100504232
Homologene: 134535
Eci2
Name: enoyl-Coenzyme A delta isomerase 2
Synonyms: HCA88, DRS1, ACBD2, Peci
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 23986
Homologene: 38145
N4bp3
Name: NEDD4 binding protein 3
Synonyms: C330016O10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 212706
Homologene: 17124
Plscr5
Name: phospholipid scramblase family, member 5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100504689
Homologene: 28688
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,197,658 bp
  • G to A, chromosome 1 at 173,274,847 bp
  • C to T, chromosome 2 at 21,746,709 bp
  • A to G, chromosome 2 at 85,951,824 bp
  • A to G, chromosome 2 at 153,399,489 bp
  • T to A, chromosome 3 at 36,921,360 bp
  • A to G, chromosome 3 at 98,072,870 bp
  • C to G, chromosome 3 at 123,080,230 bp
  • A to T, chromosome 4 at 123,503,225 bp
  • A to G, chromosome 5 at 25,314,017 bp
  • T to A, chromosome 5 at 105,118,399 bp
  • T to C, chromosome 5 at 109,219,950 bp
  • T to C, chromosome 5 at 123,613,303 bp
  • C to T, chromosome 5 at 143,254,377 bp
  • T to C, chromosome 6 at 88,893,091 bp
  • T to G, chromosome 6 at 115,797,932 bp
  • A to G, chromosome 7 at 12,670,565 bp
  • T to C, chromosome 8 at 21,583,847 bp
  • T to A, chromosome 9 at 21,281,129 bp
  • G to A, chromosome 9 at 39,592,822 bp
  • C to T, chromosome 9 at 80,258,527 bp
  • A to T, chromosome 9 at 92,205,511 bp
  • A to G, chromosome 9 at 99,496,149 bp
  • A to T, chromosome 9 at 107,522,163 bp
  • T to C, chromosome 10 at 80,381,545 bp
  • T to A, chromosome 11 at 32,193,263 bp
  • T to A, chromosome 11 at 42,487,374 bp
  • G to A, chromosome 11 at 44,531,293 bp
  • T to A, chromosome 11 at 51,653,729 bp
  • T to C, chromosome 11 at 54,676,394 bp
  • A to G, chromosome 11 at 120,785,182 bp
  • T to A, chromosome 12 at 83,668,457 bp
  • A to T, chromosome 13 at 34,990,267 bp
  • C to T, chromosome 14 at 31,274,044 bp
  • A to G, chromosome 14 at 96,201,380 bp
  • T to C, chromosome 15 at 47,650,221 bp
  • A to T, chromosome 15 at 48,540,333 bp
  • T to C, chromosome 15 at 77,791,764 bp
  • T to C, chromosome 15 at 81,601,495 bp
  • T to C, chromosome 15 at 91,910,370 bp
  • T to C, chromosome 15 at 102,981,881 bp
  • T to C, chromosome 16 at 45,116,378 bp
  • TTGCTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGGTGCTGCTGCTGCTG, chromosome 17 at 50,799,955 bp
  • T to C, chromosome 17 at 74,697,425 bp
  • T to A, chromosome 18 at 80,272,478 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5701 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043181-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.