Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5578Btlr/Mmmh
Stock Number:
043133-MU
Citation ID:
RRID:MMRRC_043133-MU
Other Names:
R5578 (G1), C57BL/6J-MtgxR5578Btlr
Major Collection:

Strain Information

Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: pCIP, TRAM-1, AIB1, RAC3, TRAM1, Src3, 2010305B15Rik, KAT13B, bHLHe42
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Cyp39a1
Name: cytochrome P450, family 39, subfamily a, polypeptide 1
Synonyms: oxysterol 7-alpha-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56050
VEGA: 17
Homologene: 9580
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Usp19
Name: ubiquitin specific peptidase 19
Synonyms: 8430421I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71472
Homologene: 41730
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Mdm2
Name: transformed mouse 3T3 cell double minute 2
Synonyms: Mdm-2, 1700007J15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17246
HGNC: HGNC:6973
Homologene: 1793
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ESR, ERalpha, ER[a], Nr3a1, ERa, Estr, Estra, ER-alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Csnk2a1-ps3
Name: casein kinase 2, alpha 1 polypeptide, pseudogene 3
Synonyms: Gm10031, Csnk2a3, Csnk2a1-rs3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039026
Clca4b
Name: chloride channel accessory 4B
Synonyms: AI747448
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99709
HGNC: HGNC:2018
Homologene: 40808
Mpp7
Name: membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms: 5430426E14Rik, 2810038M04Rik, LOC381166, 1110068J02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75739
VEGA: 18
Homologene: 1455
Zfp445
Name: zinc finger protein 445
Synonyms: ZNF168
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235682
VEGA: 9
Homologene: 27832
Cachd1
Name: cache domain containing 1
Synonyms: 1190007F10Rik, Vwcd1, B430218L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320508
Homologene: 10854
Gm6445
Name: predicted gene 6445
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 19
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Aqp11
Name: aquaporin 11
Synonyms: 1700015P13Rik, sjds
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66333
Homologene: 18269
Dnai3
Name: dynein axonemal intermediate chain 3
Synonyms: 4931433A13Rik, IC140, Ida7, Wdr63
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242253
Homologene: 44922
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Taar1
Name: trace amine-associated receptor 1
Synonyms: Tar1, Trar1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 111174
VEGA: 10
Homologene: 24938
Slx4
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: D16Bwg1016e, Btbd12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52864
Homologene: 23770
Cep89
Name: centrosomal protein 89
Synonyms: 2610507L03Rik, Ccdc123
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72140
Homologene: 12444
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Vmn2r120
Name: vomeronasal 2, receptor 120
Synonyms: EG224916
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224916
Arhgap40
Name: Rho GTPase activating protein 40
Synonyms: Gm14203
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545481
Homologene: 53500
Fam89a
Name: family with sequence similarity 89, member A
Synonyms: 2310031A18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69627
Homologene: 18887
Itm2c
Name: integral membrane protein 2C
Synonyms: BRI3, 3110038L02Rik, ITM3, Bricd2c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 64294
HGNC: HGNC:6175
Homologene: 11186
Gm20730
Name: predicted gene, 20730
Type: Gene
Species: Mouse
Chromosome: 6
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Thnsl2
Name: threonine synthase-like 2 (bacterial)
Synonyms: TSH2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232078
Homologene: 5489
S1pr5
Name: sphingosine-1-phosphate receptor 5
Synonyms: lpB4, S1P5, Edg8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 94226
Homologene: 11031
Fstl4
Name: follistatin-like 4
Synonyms: B230374F23Rik, SPIG1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320027
Homologene: 18543
Stambp
Name: STAM binding protein
Synonyms: 5330424L14Rik, 5730422L11Rik, Amsh
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70527
Homologene: 4719
Cfhr2
Name: complement factor H-related 2
Synonyms: FHR-B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545366
Homologene: 134349
Smyd4
Name: SET and MYND domain containing 4
Synonyms: G430029E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319822
Homologene: 35098
Zfp84
Name: zinc finger protein 84
Synonyms: C86188, Zfp69, KRAB18, 4633401C23Rik, 2210410P13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74352
Homologene: 51858
Cybb
Name: cytochrome b-245, beta polypeptide
Synonyms: gp91phox, gp91phox, Nox2, Cgd
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 13058
HGNC: HGNC:2578
Homologene: 68054
Sh3d21
Name: SH3 domain containing 21
Synonyms: 1700029G01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66938
Homologene: 12057
H2ac21
Name: H2A clustered histone 21
Synonyms: H2a-613a, EG621893, Hist2h2ab
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 621893
Homologene: 111318
Pm20d1
Name: peptidase M20 domain containing 1
Synonyms: 4732466D17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212933
Homologene: 65049
Trmt5
Name: TRM5 tRNA methyltransferase 5
Synonyms: 2610027O18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76357
VEGA: 12
Homologene: 6096
Sult5a1
Name: sulfotransferase family 5A, member 1
Synonyms: Sultx1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57429
Homologene: 129532
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 14,887,008 bp
  • T to A, chromosome 1 at 85,903,053 bp
  • A to G, chromosome 1 at 131,816,022 bp
  • A to T, chromosome 1 at 139,470,717 bp
  • A to T, chromosome 1 at 139,831,068 bp
  • A to G, chromosome 1 at 156,525,230 bp
  • G to T, chromosome 2 at 158,531,206 bp
  • A to G, chromosome 2 at 166,054,328 bp
  • C to T, chromosome 3 at 55,784,014 bp
  • T to C, chromosome 3 at 86,757,507 bp
  • A to T, chromosome 3 at 93,444,311 bp
  • T to C, chromosome 3 at 96,220,238 bp
  • T to A, chromosome 3 at 144,932,435 bp
  • A to T, chromosome 3 at 146,097,228 bp
  • A to G, chromosome 4 at 8,847,149 bp
  • A to T, chromosome 4 at 32,728,167 bp
  • A to G, chromosome 4 at 100,865,006 bp
  • A to T, chromosome 4 at 126,150,683 bp
  • A to T, chromosome 5 at 141,613,125 bp
  • T to A, chromosome 6 at 43,081,540 bp
  • C to T, chromosome 6 at 71,138,765 bp
  • T to G, chromosome 6 at 83,561,800 bp
  • A to C, chromosome 7 at 29,775,431 bp
  • ACTCCTCCTCCTCCTCCTCCTCCTC to ACTCCTCCTCCTCCTCCTCCTC, chromosome 7 at 35,409,642 bp
  • A to G, chromosome 7 at 97,737,458 bp
  • G to T, chromosome 8 at 123,143,121 bp
  • T to A, chromosome 8 at 124,741,229 bp
  • T to A, chromosome 9 at 21,244,551 bp
  • T to C, chromosome 9 at 108,493,440 bp
  • T to C, chromosome 9 at 122,853,337 bp
  • A to C, chromosome 10 at 4,969,164 bp
  • A to T, chromosome 10 at 23,920,820 bp
  • C to T, chromosome 10 at 117,702,287 bp
  • T to A, chromosome 11 at 53,165,781 bp
  • C to T, chromosome 11 at 75,404,776 bp
  • C to T, chromosome 12 at 73,285,063 bp
  • A to T, chromosome 12 at 118,018,802 bp
  • C to T, chromosome 13 at 55,012,181 bp
  • A to G, chromosome 13 at 89,691,503 bp
  • T to A, chromosome 16 at 3,986,862 bp
  • A to G, chromosome 16 at 31,108,114 bp
  • T to A, chromosome 17 at 43,680,140 bp
  • T to A, chromosome 17 at 57,522,514 bp
  • T to C, chromosome 18 at 7,355,101 bp
  • C to A, chromosome 19 at 9,607,489 bp
  • C to G, chromosome X at 9,450,750 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5578 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043133-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.