Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR5547Btlr/Mmmh
Stock Number:
043105-MU
Citation ID:
RRID:MMRRC_043105-MU
Other Names:
R5547 (G1), C57BL/6J-MtgxR5547Btlr
Major Collection:

Strain Information

Lhx5
Name: LIM homeobox protein 5
Synonyms: Lim2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16873
Homologene: 40621
Aldh7a1
Name: aldehyde dehydrogenase family 7, member A1
Synonyms: Atq1, D18Wsu181e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110695
HGNC: HGNC:877
Homologene: 913
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Rnf40
Name: ring finger protein 40
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233900
Homologene: 8856
Arfgef1
Name: ARF guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Trim24
Name: tripartite motif-containing 24
Synonyms: Tif1a, D430004I05Rik, A130082H20Rik, TIF1alpha
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21848
Homologene: 20830
Chek1
Name: checkpoint kinase 1
Synonyms: Chk1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12649
HGNC: HGNC:1925
Homologene: 975
Tmem245
Name: transmembrane protein 245
Synonyms: A630051L19Rik, D730040F13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242474
HGNC: HGNC:1363
Homologene: 41841
Secisbp2l
Name: SECIS binding protein 2-like
Synonyms: 3110001I20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70354
Homologene: 18923
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
C6
Name: complement component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12274
HGNC: HGNC:1339
Homologene: 47
Tbc1d1
Name: TBC1 domain family, member 1
Synonyms: 1110062G02Rik, Nob1, Nobq1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57915
Homologene: 56856
C1qtnf2
Name: C1q and tumor necrosis factor related protein 2
Synonyms: 1810033K05Rik, CTRP2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69183
Homologene: 12899
Adgra3
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70693
Homologene: 19235
Tdo2
Name: tryptophan 2,3-dioxygenase
Synonyms: TDO, TO, chky
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56720
Homologene: 4132
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Gamt
Name: guanidinoacetate methyltransferase
Synonyms: Spintz1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14431
HGNC: HGNC:4136
Homologene: 32089
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Flt1
Name: FMS-like tyrosine kinase 1
Synonyms: vascular endothelial growth factor receptor-1, VEGFR-1, VEGFR1, Flt-1, sFlt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14254
HGNC: HGNC:3763
Homologene: 134179
Ptprh
Name: protein tyrosine phosphatase receptor type H
Synonyms: SAP-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545902
HGNC: HGNC:9672
Homologene: 37693
Rnf112
Name: ring finger protein 112
Synonyms: bfp, Zfp179, neurolastin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22671
Homologene: 5176
Avpi1
Name: arginine vasopressin-induced 1
Synonyms: 2310008N12Rik, mVIT32
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69534
Homologene: 11027
Or5ac19
Name: olfactory receptor family 5 subfamily AC member 19
Synonyms: GA_x54KRFPKG5P-55483936-55483010, MOR182-2, Olfr201
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258996
Homologene: 37011
Cryz
Name: crystallin, zeta
Synonyms: quinone reductase, Sez9, SEZ9
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12972
HGNC: HGNC:2419
Homologene: 133907
Cep126
Name: centrosomal protein 126
Synonyms: AK129341
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234915
VEGA: 9
Homologene: 28313
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: LOC239151, Gm600, SLIP-GC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Fam20b
Name: FAM20B, glycosaminoglycan xylosylkinase
Synonyms: C530043G21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215015
Homologene: 8909
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Cbr1
Name: carbonyl reductase 1
Synonyms: CR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12408
HGNC: HGNC:1548
Homologene: 37524
Ctsll3
Name: cathepsin L-like 3
Synonyms: 2310051M13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70202
VEGA: 13
Homologene: 134916
Bank1
Name: B cell scaffold protein with ankyrin repeats 1
Synonyms: A530094C12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242248
Homologene: 9926
Daxx
Name: Fas death domain-associated protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13163
HGNC: HGNC:2681
Homologene: 1033
Zfp946
Name: zinc finger protein 946
Synonyms: 1300003B13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74149
Pgpep1
Name: pyroglutamyl-peptidase I
Synonyms: PGP-I, Pcp, 2810003H13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66522
Homologene: 9793
Gpr161
Name: G protein-coupled receptor 161
Synonyms: LOC240888, vl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240888
Homologene: 17824
Eya4
Name: EYA transcriptional coactivator and phosphatase 4
Synonyms: B130023L16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14051
VEGA: 10
HGNC: HGNC:3522
Homologene: 3025
Zfp957
Name: zinc finger protein 957
Synonyms: AU017455
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105590
Ifi44l
Name: interferon-induced protein 44 like
Synonyms: NS1178, H-28, H28
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15061
Homologene: 48468
Zfp850
Name: zinc finger protein 850
Synonyms: C130069I09Rik, Gm4636
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043772
Trpv6
Name: transient receptor potential cation channel, subfamily V, member 6
Synonyms: CaT1, Cac, CAT, Ecac2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64177
Homologene: 56812
Klhl3
Name: kelch-like 3
Synonyms: 7530408C15Rik, EG627648
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100503085
HGNC: HGNC:6354
Homologene: 79542
Gm11127
Name: predicted gene 11127
Synonyms: Gm11127
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100529082
Homologene: 133121
Trmt112
Name: tRNA methyltransferase 11-2
Synonyms: Trm112p, 0610038D11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67674
Homologene: 41132
Cdip1
Name: cell death inducing Trp53 target 1
Synonyms: 2700048O17Rik, CDIP, 5730403B10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66626
Homologene: 40879
Lekr1
Name: leucine, glutamate and lysine rich 1
Synonyms: EG546798, Gm6534
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 624866
Homologene: 54497
Prr19
Name: proline rich 19
Synonyms: EG623131
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 623131
Homologene: 85197
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 10,160,976 bp
  • A to G, chromosome 1 at 150,737,506 bp
  • A to C, chromosome 1 at 156,705,646 bp
  • C to A, chromosome 1 at 165,306,413 bp
  • C to T, chromosome 2 at 125,740,737 bp
  • T to A, chromosome 3 at 65,669,180 bp
  • T to C, chromosome 3 at 81,958,940 bp
  • T to C, chromosome 3 at 100,056,152 bp
  • T to C, chromosome 3 at 136,066,349 bp
  • C to T, chromosome 3 at 151,761,505 bp
  • C to T, chromosome 3 at 154,611,557 bp
  • G to A, chromosome 4 at 6,426,429 bp
  • C to T, chromosome 4 at 56,910,156 bp
  • A to T, chromosome 4 at 144,158,028 bp
  • A to G, chromosome 5 at 49,999,292 bp
  • A to G, chromosome 5 at 64,324,544 bp
  • G to A, chromosome 5 at 76,230,338 bp
  • A to G, chromosome 5 at 120,434,610 bp
  • T to A, chromosome 5 at 147,655,138 bp
  • A to G, chromosome 6 at 37,965,550 bp
  • A to T, chromosome 6 at 41,636,154 bp
  • G to T, chromosome 7 at 4,554,222 bp
  • A to C, chromosome 7 at 25,303,963 bp
  • A to G, chromosome 7 at 27,989,419 bp
  • G to T, chromosome 7 at 102,013,930 bp
  • T to C, chromosome 7 at 127,589,130 bp
  • T to C, chromosome 8 at 70,652,419 bp
  • T to C, chromosome 9 at 8,100,427 bp
  • T to C, chromosome 9 at 36,712,104 bp
  • T to C, chromosome 10 at 23,109,854 bp
  • G to T, chromosome 10 at 80,259,272 bp
  • C to T, chromosome 10 at 107,782,048 bp
  • A to G, chromosome 11 at 43,490,967 bp
  • C to T, chromosome 11 at 61,451,028 bp
  • C to T, chromosome 13 at 58,102,429 bp
  • T to A, chromosome 13 at 60,800,737 bp
  • A to G, chromosome 14 at 65,641,881 bp
  • T to C, chromosome 14 at 79,213,966 bp
  • T to A, chromosome 15 at 4,808,488 bp
  • G to A, chromosome 15 at 76,705,794 bp
  • A to G, chromosome 16 at 4,770,124 bp
  • G to A, chromosome 16 at 59,269,116 bp
  • T to A, chromosome 16 at 93,609,810 bp
  • T to C, chromosome 17 at 22,454,892 bp
  • TGATGATGACGATGATGACGATGATGA to TGATGATGACGATGATGA, chromosome 17 at 33,912,641 bp
  • CGATGATGATGA to CGA, chromosome 17 at 33,912,659 bp
  • G to A, chromosome 17 at 36,057,904 bp
  • T to G, chromosome 18 at 20,336,040 bp
  • A to G, chromosome 18 at 56,528,284 bp
  • T to C, chromosome 19 at 6,910,788 bp
  • T to C, chromosome 19 at 17,752,124 bp
  • T to C, chromosome 19 at 42,124,943 bp
Genotype Determination
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R5547 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
043105-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.